Description :
From Genome Similarity Track
Location :
Scaffold_1:1716856- 1719768
Sequence
2912 bases(100 bases per row)
TCCGTAGTACCCTTGTACGACTTGGGTAGCGAAGGTATGTGATCCATCGCTATGATCTGGAACGGGTATGTCGCCTGGATGTTTCCCGGCGACTCGCCCC
TGATCGTGGGTCGTCCTTTGCCGGTCTCGCAGTCGACACATTCGCCGACGTACTTCTGCACACTTCTGAAGAGACCTCTCCAGTGAAAGTGATCGTGGAT
CCGCTGGTATGTACGCCCGATCCCTTGGTGTCCACCTTCCAGAGTGGAGTGATAGTGATGCAGGATGTCTTGATGCAGCGTCTCCGGTGCCACCAGTCTC
ATCAGTCCATCTCGATCTGCATCCGATCGCTTGGAGGGTGGGCAATAGAACAGCAGATTATCACCGTCGATCCCGTAGTCCGCTGCGAGGTTGCCATAGG
ATCGGGCCTCATCCTGTGTCACATCAGCCACATCTCCCATCAGATATTTCTTCATACCCGCGATCCACGTTTCTTCATCCTGTGCTCGACGAATCCGATC
GATCCGCAACCCTCGCACGAACTCCTCCTGCATGACGGTCGGGTTCGGCCGTGATCTGGTGCCCGATCGGGTTGTCGTCGGAGATAGTCGGGCGATCGAC
TCATCCGACCGGACGACCAGGATCTCATCAAGTCGGTTCAGTGTCACTAGATCCCCATGATCGGCATCCTCCTCGACGATGACGCCCCCTTCACGTTGGA
GTGCTGCACTGGCCAGGCTGTCCGCACTTCCGTTCCAGTCTCGTTTCACATGTAACAGCTCGTGATCTGGCCAGTTCCGTAGCTGATCCAGCACCTTCTG
CTTCAACAATGTCAGCTTAGGTGCTTTGCCGTCAATCTCGCCCCGTACTTGTCGGATCACCAGGTTGGAGTCACCGCAGACCACTAACCTGCCTCGACCT
ATGCCGTCCAGGAGGTCGAAACCCAACAACAGACCATCATACTCCGCCTCGTTAACAGTCAGCCCTTCGGCATAGCCCGATCAAGCCTTCACCACACTCC
ATTCGGGTAACTTCCACAAGATTGCAGTGTACGCGCCCCGCCTCGCTTGACGCGGGCGGATCCATCGAAACTCATCACCAGCAGCTCTTCGTCCGCACGC
ACCGTCGGGATCGGGGCTTGAATCTTCCGCCGGGGTTCTTTCTTCGGCGCGATCGCGATCAACGCGTCGTACAGATCCGATCGAGGCGTAATACTAGCGG
CGATCGCCCCCAATATCTCGTCCTCTCCCTTGGTGCACTTCGTGATCTCCAGTGTCCAGGACGATAGGAGTGCAGCCCACTGGCCCAATCGGCCTCGAAG
ACCAGATGATCGGAACAGCCACGCCAACGTCGAGTGTCGGGTCAAGACCCGGATGGATCGTCCAACCAGCATGTTATAGTTCAGGTCCAGGATCCGTAAC
AGCGCCAGTACTTCTTTCTCCACCACATTGTAATTCAGTTCATTCGACTTCAGCGTTCGACTGGCGAAAGTAACGGGATGATAGATCTGGTCGTGCTCCT
GCATCAATGCGGCCGAGATCGCCCAGTCACTGGCATACACAATCACGACCGGAGTCCGATTGCGATCGAAGTGCCGCAGGATCGGTGTCGTCGCGATCTT
CATCTTCAGGGTCGAAAGGGCACGATGAGCACGGATCCAGCGTTCATCGGCTACACCGACTTCAGGAACTGATGGAGTCCGATCGGGGTTCACTGGGTCC
GTATCCACTAAGTTCAGTACTTGACGATCCAGGATCTGGTGCAGATCGGGGCGTTTCTTCAGCTCGGCGAAGTCCACCTCGCGCAGTTCGTACAGGATCG
CTGCGTAGATCGCGTAATCTTCCAAGAAACGGCTGTAATAATTGAGACTGCCCAAGAACGACTGCATCGATCGGAGTGATCCGGGGAACGGCAGATCAGT
CAGAGCCGTGAGATCCTTCGGATTGGCCTCTAGCCCGTCGTTCGACACCCGATGTCCCAGATAGTCCACCTTACGCATCCCCCAAGAGCTCTTCTCCACA
CTGATCGAGAGGTTCCACTTATCACAAGCGTCCAGCAGGTGATCCACGCGATCACACAGCTCGTCCCATGACCCGGCCGTCACCAAATGTCGTCAATATA
CGATCTGCGACCTAGCACTGATGGACGCCCCGGATCTTCTGGTTCTCCTGACTCGATCAAGTCCGTAGTGACTTCACAGCCCGACGATCGCGGGATCCTG
GTGAACCCATACAACGCGTCGTCCAGAAGTCGCTGGTAGATCTGAGGAGCGTTCTTCAAGCCGAACGGCATCCGGTTCCACTCGAACAGACCCATGTGGG
TGATAAAGGCCGAGATCGCATGAGCTCGATCGGTCATTGTCACCACCCAGAATCCACTAGCCATGTCCAAAGAGCAATACCAGAGTACCTTATCCAGATC
CTCCAGCAAATCGTTGATCAAGGGCATCGGATATACCATCAGCCTGGTTAGACTGTTGACGAGCCGATAATCGATGCAGAGTCGGATATCCACGCCGTTC
TTCTTGATGATCACGACAATCGGCGAGGCCCACGGTGATCGAGATTTCCGAATCATCTTGGCTGACAATAATCCCTTGATCAGCTCGGACACCTTCTCCA
CGAACTGAGGGGCAACTTTCCGGACGCGTTGAGCGATCGGCTTCGCGTCGCCCACGTCGATGTCGCAGGTGACGCCCCGGGCTGCTGGGGGAAGTGGATT
GCCCTTGCCGATCAGCAGGTGATTCCTGTGCCAGATCTTCTTTCGCAGCCGATCGATCTCCTCCGGGGTGTTGAACTCCAGATCTCCCATCTTGATATCA
TCGATCGTCACCTCATCCGTCGTCGAGATCACAATTTCAGGAGCACAGCTAATTCACCTTCGACATCTTCTGCTGACAGATTCCTGCCCTCGTGATAATG
GACCTGATCATC