Description :
From Genome Similarity Track
Location :
Scaffold_208:17165- 18576
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_208-snap-gene-0.24Dicarboxylate/amino acid:cation

Sequence
1411 bases(100 bases per row)
GTCCTGATGCGCAGCATCAAACGTCTCGTCGACCTGCTCAGCGACGATGCGAGAGACGTAGGTGTCGCCCACCACGTTGCAGACTGTGTTGATGCGATCG
AGGTACCAGTAGATGGCCACAAGGAATGAGTAGGATGCAGGCATGTCGTGGTTGGGAAAAATCGTGGACCAAATTGAGTAAACCATGACGAGACCGCCGT
TCGGGATGGGCGCAACGCCGATGGAGCTCAGTAGTGATACCAAAACGATAAGTATCACCTGCACCCAACCCAGTTCGATCTCTGAAGTAGAAGTGGTGGC
CAAGAACACCATGGCGTTAGGGAAGAGCATGGCcGTGCCATTCATGTGTACAGTCGACCCAATCGTCACGACGAAGCGAAGGAGCGAACGCGAGACTTCG
CGCGTTGACTCAACACAACGCAGAGTgaCTGGAAGCGTCGCAATCGAAGACGCACTGCCGAATGCAAAGTaGACaCACGGCAGCATCTGCTTCATGTACT
TGAACGGGTTctGACtCGTGGTGATATAAAGCATTAAAGGGTAGACGCCGAGTTCGAAGATGGTGACGGTAATGAAGTTGCATAGTACAAGGACCCCAAC
ATTGTTGATCGCTTGCTCCATGGACTTCTGACTTGAGAGCGAACCGGCGATCAATGACAATACCGCCAAGGGGCTCCAGCCAATGAGTTTCGCAATGACG
AAGAAGAAaATTTTGTtCATCTGGTTCAATAGATCAAGCAGTGGGCTGCTCTGCTGAGAGCTTGTGCGCATTGCAGCAGCACCAAACGCAATGGCGAACA
TAATCACACTCAATAGCACTCCACTCTCAAATGCAAGTGCGATGTTTTGAGGAATGAGTGACTGGAGAATCTGTGTGAATTGTTGCGAGACACTGAGCTT
GGAAACAGGAGTCGAGTCGATAACAGCCCCAGAAAGATCAATGATCTCGAACTCAGTCAAACTACTCATTTTtGTCGCTGTACATtGCAAACTTGAATCG
TTGGCTTGCTGCAAGAAGAACTCAGGCGCACACTGTACATGTAAAAATGCGCGCGCTTTGGCTCGAGGGACGTACGCTTGGTGTGGATGTAAGgATCGCA
GTGaCaTGGCGACTATCAGCGACAGAGTAGAaGCAATTCCCGAAAAGAAAAGGAAGTAGAGCGCTGTGCGTGTGCCGACTGCAGACACCTTGCCcAGGAG
GACGATGCTGGCAACTCCTGTCGACAGGCTGCAGAAGACCATAGGAATGACGAAACACTTGAGTACGCGAAGGAATATTTTTCCAGGTAGATTCACGATC
TCACTGACATCGGATGAGACCTCGAGGTGGGAGAGCAGAACACCAAGCGCAATGCCAAGAATGACCCCGATGATGATCTGTGTGTTAGTGCGTCGCAAGA
AAGCGAAGCGC