Description :
From Genome Similarity Track
Location :
contig_113:17162- 19289
Transcript NameFunction/comments
g11258.t1hypothetical protein

Sequence
2127 bases(100 bases per row)
TTTCCTTCCCCACCCAGAGTGGAGCCACGAGGCATCGTGGGGAGGCCCACGGCGAGCAGAGCGGGAACGCGCGGGTGCCGCGCGTTATTTACAAAAAAGG
GGGTCAGACCCGTCGATGCGTGTTCTGCGTTGTTTAGCGCAAACTCGGCAAGCGGCAAAAAGGAGCTCCAACTAGTGAACGAAGTCGCGTAACTTCGAAG
GACATCTTCGAGGACTCGGTTGACCCGCTCCGTTTGACCATCCGTCTCCGGATGCGCCGCCGTTGACATGAGCAGCTTCGTTCCCAGAAGTTGGAAGAGA
CTCGACCAGAATGCCGACGTGAACCGCGGATCGCGGTCAGAGACGATCGATTCAGGTAAGCCGTGGTGTCGAAAGACCGCGTCAACGAAATGCACCGCGG
ACTCAGCCGCGGTGATCGTGTCGGACACCGGAATGAGATGCACCATCTTGCTGAACCTATCCACAAACACCAAGACGCCAGTCCGACCGTCGGCATCGGG
TGGAAGCCCGAAGATGAAGTCCATCGACACTGAGCGCCACGCCTCAGTTGCAATCGGCAGGGGTCGCAGGGGAGCCTGCGACGACTTTGACGGCTTCACG
CGCTGGCAAATCTCACAAGTACGGACCCACTTGCGCACCCATTTGTACATGTGGGGCCAGTAGAAGTCGCGGGATACTGCCGCGAACGTCTTTTCGCGGC
CCAAGTGACCACCGACAGGGCTGTCGTGGAACTCGTGGATGATCCGAGCGCGCAGATCATCGTCGTTCGGGATGGCGATGCGGGGAGCATCGAATCGATC
GATGCTGTACGTCAGCAGATCGCCGTCGAGTTGATATCGGTTAATCTGATTGCGCGTGTTGTTCGGCAGCGCGTGGAGTGTTTTATCACTGGGGGAAAGA
AGATGTGCGAGGATGGCGGCATATACCGCGTCGTCGTTGTACGCAACGGCAATTTCTTCGCGTAGCGGCATTTCTGGAGTCACGTTCATCAGGTTGACAC
CTGATGTCAAGCACATCGCGCAGTGATCTTCGTCATCCTCGTCTTCGTCAATCACTTGACGACCCCGCGTCGCTCGTGGATCATAGTCTGGACTCCGAGA
CAGAGCATCGGCGAGGATATTGTTCTTGCCGGGCTTGTAGTGCACGACGAAGTTGTACTCAGCGAAGAACGACAGCCATCGTGCCATGCGTTGAGACAGA
TGTGGAGACTTCATCGCTGTGCGCAGCGATGCGTGATCCGTGTACACCGCGAACGTCTGTTCTCCGAGCAGGTACACTCTGAATTTGATCAGAGCGTATC
GCATCGCAAGAAGTTCCTTGTCGTGGACGGGATAGTTGCGTTCGGCCGGCTTCATCTGTCGTGATTGATAGCTCACGACTAGTTCGCGGCCTTCGTTGTC
AAACTGCGTGAGCGCGCACCCGATAGCAAAGTCGCTAGCGTCGCAGACGACGTGAAACGGTTTCGCGTCATCTGGGAGCATCAGTATTGGCGCCGAGGCC
AAGCTCTTCTTCACCGAGTCGAAGGCTACTTGATGCTCGGGGCCCACGACCACGTGGCGTCTTTCTTCAACAGCGACGACAGTGGCTGTATCAAGCCGGC
ATATCCCTTCGTATACTTGTGCAAGTAGTTAGCGAGGCCCAACCACTGACGCAGCTCAGTGGGGTTTGATGGTGGTGGCCACGAGCAAATAGACGACACT
TTTTCCGGGTCAGCACGGACTCCGTTTTTGCTTACGTAGCACCCAAGCACCGGAATTTCCGGCGCGCAGAAGACACACTTCTTGAGATTCGCGTAGAGCT
TGTTCTCTCTCATCACTTGAAAGACCTGCCTCAAGTGCCGCAGATGCACGTCGATCGCGCTGAGACCCTCTTCAGCGTGACTGTGCACAAAAATGTCATC
GAAGTAACTCGGAGCGAAGTCACGAAGCGGGCGTAGCACATGGGACACCATGCGATTAAATGTGGCTGGTGCGTTCTTCAGACCTTGGGGCATCACGAGC
CACTCCCAGAGCATACCGCTGGGCGTACTGACTGCCGTGAGAGGTACATCGCTCTCTCTCATGAGGATCTGATAGAAGCCATCGGTCAAGTCGATGGCAC
TGTAAATGACGCTGCCCGACATGGTGT