Description :
From Genome Similarity Track
Location :
Scaffold_465:1716- 3578
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_465-snap-gene-0.12Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_465-fgenesh-gene-0.7Replication factor C subunit 2

Sequence
1862 bases(100 bases per row)
CCGAGAGTGCCTCTGTAGGTTCCAACTTGCATCCTTCATTCCTATATACAACCATTCTCAATATCAGGGTGTATATATAGCGAGTGAGAACTCAAATTAG
ACTGTTAACCATAGCCGATGGCATGGTCTTGGTCTTGGTCTTACCAGTACGTTTGACGTTTGCTCATGGGTATGGAAGGAAGCAAGTGATTGCCTCACAC
AACACAGACGTACACACAGTCACTCGAGACCGCGCTAGCATCACAGCAGGATGGACAGGGCCTCGCGCGACGGCGGCTTCAGCGATCCGTCGTTTGTGAG
CGTGGGCGACCCGTACACGCAGAAGAAGCCCAAAGACCGCGGGCTCGGCGACGACCTCAAGCCGTTCCTCACATGTCCCGCCAAGAAAGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGGGCATCCCGGGCGAGTACACCGAGCCGTACAAGCTCGAGGCCAAGCGCCGCCTGGAGAACACCAAGAA
GTTCGTCAAGCCTAGTGGCTTCACGTTCTCGTCGCCGACCAAAGAGCAGTACGTGGCGGCGTACTTGATTCACTCATTGGTTGCTTGTTTTGTCTGGGGT
ATGCTGTAGACTCTACTAACCGGCTTTGGCTGTTTTGTGTGTGATTGGACTTGGTGCTGCTGTTACTTGTTTGTGTGCGATGCAGCACGGGCTCGGGGGA
CTACTTTGGCGCGTTCGACAAGTATGAGCGTAGCGAGGAGGATATAAAAAAAGCCCAGGAAGAGAACGCCAAGGCACGACCGAACCCGAAGGACAAGGCG
TTCGAGGTTCGTTCTCTCTCTTTTGTATTCCTTATCCGATTTGTGGTGCTTTGCTGCATTGAATGCATTCTGAACCCATGTTCTGTTTGTATTTCGCAGA
AAAAGAACATCCTCACCAATCCGGCAAAGCGCGGCACGTTCGGATATGCGGGCACGATGATCGGCGGCAGTAGCATCCCCGCTGTGACCGCGGAGTTCGA
GTCCGAGCGGCTGGACGCACGCAAAGATCTGGAGAAGCACCGGCAGATCATGGGCGACAAGAAGGCGTTCAAGTCCACCGCCACAGGCGTCGACTACTTT
GACGCACACGAGCACGTCGCGGCGCCAAAGATGCTCGGCTGGGACGACACGTGCATCGTCAAGGCCTCGGGGGCGCTCGAGCTCATGAACCCGAAGGAGC
GCGCGACCACCAAGGCATCGACGTTCAAGCCGTGGAAGCCCAACAACCCGATCAAAAAAGGCGACCAAGGGTAGGTTCTTGAGATGCTTGACTGTCACTG
ATTGAAGTGAGCGGCCGCCGGAGTTTGGTGTGTTCGCTTCCACTGACTGGTTTGGTATTCATGTCTTTTCGTTGCACTTGCATCACCACCATCACCGCAA
CAACGGCACAGCACGTTTGAGCGGTTCACGGAGCAGCAGCCGGATCCGTACGACGAGAGTGTGATCAACCGCGCGATGCTGCCGAACCGCCGGCACCCGG
TCAATTCGGCGACGAAGGACCTTCCGGAGTCGCTGCGCGAGCGCAAGGCGTTCCGACCGAGCAGCTTCCCCAAATCCAAGCTTACCAAGGGCACGTGTCT
ACTCGGGATCTCCAAGCACAAGCTGTAAGGCGTGAGCCGCCATCCACTAGATTCGAGCTTCGAACTAATAAATATACTATAAACCACAGCAGCAAATAGA
CCCATGTAGCACCATGAAAAGAGAGAGAATGGCTAAGGGCATTATATATTTACTGTAGGAATTGGTTTGCTGATCGTAGGTTCACCCTCATGATAAGCTT
GGAAGTTGGTATGCTCTAGGATGCCCGCGCGGCCGCGGTGGCGGTCGAGCACAGGCGCGCGA