Description :
From Genome Similarity Track
Location :
Scaffold_1:171570- 196538
Transcript NameFunction/comments
g48.t1RAW41902.1 hypothetical protein PC110_g1892 [Phytophthora cactorum
g49.t1RAW41903.1 hypothetical protein PC110_g1893 [Phytophthora cactorum
g50.t1hypothetical protein
g51.t1KUF78859.1 E3 ubiquitin-protein ligase HERC2 [Phytophthora nicotianae
g52.t1XP_009515427.1 hypothetical protein PHYSODRAFT_293759 [Phytophthora sojae
g53.t1KUF78857.1 hypothetical protein AM587_10010796 [Phytophthora nicotianae
g54.t1hypothetical protein
g55.t1hypothetical protein

Sequence
24968 bases(100 bases per row)
ATCTTCAAGCGCCGCAGTCCGTATCATGAAGATTCGCGTGCGCTTCCTGCTCGGTGCGTCCTGGGCAGTGTCCTCTGGGCCTCTCGCTACAAGCTAACAT
CCCCACTCACTGCGCAGGCAACGCGTGCAGCTTCGTGTCGCTGGTGCTGCTGCTGGCGGCCTGCAGCGGCCAGAAATGGGCGCACGACGCCGTCAACTCT
GTAGACATCGGCCTCTGGTTCCTCACGGTGCGATGCAGGCGAGATAATTACCGTAGGGCGATTGAATCTCGCACGGGATACACCTTTTCTGACGGTCATT
CTCTGCGGTTCAGGGGACTGGCGTGCGCTACAAACTCATCAACGCTGGCGCCGCGGTCGAAAGCTCCGACGTCACGTCGGCGGACCAGGCTTTCACGCTC
TACAGCCGCTTCTGGTAGGGTCTGTTGGCTGAAGCTCTCTGCTGCTGTTGCTGCTGCTAATCGCACCCACTGACGTTCGAGTGTGCAGCGCCCTCTCGGT
TGTTGCCTCCAGCGACCCGTGGTGTCTTGAGGATGCCACAGCCACGAGAGCTTTCACTGTCTTGGCGCTGATCGCCGCTATTGTCAGCTTCCTACTCAGC
GTCATGGTGGCCTTGGACATCAAGATCCCCACGTGGAATGGGGAGGGCAGGGAGGCGACGCTGGTCACGCCCGCGGTGTGCTCGCTGTTTGAGACGATCG
CGCTGATCCCGGCCGTGACGCTGTGGCAGCGCATGGTGACGGTGTATGACGAGCACTGCCGCGAAACCATGAAGATCAATACGTTCACATGCATCAAGAC
AGGATCAACGCATACATTTGCCACAGCTGCGATCCCGTTTGCTGCTGTCACCTACGTGCTTTGGCGGTTGTCGCATTCCTACGATGTAGGGATCTCCATT
CATGCCATGGCACTGTCTCCTGGCTGAACATCGTTGCGCTCTGTGCTAATTAGGAAGCAAAACGAGCCGGCAGAATTGCCGATGGCTTTACGCTGGCTGC
GAAAACAGGCACGATGACTGTGACCAGGCTAAGCTTAAAAGCTGAGTGATCCAGTGGTTGACATTATCTGCTTTCTACCACACGCTTAGACAATGTGGAC
GAGATTCTGTCTGGCATCGCCAACAAGATCGACATCGACGCAAACGGCTCAGACGGCAGAAATGCGCTGCACTGGGCGTGCACGCTGCACCGGACGAGCA
TCTGTCACGTCTTGCTGAAAAAGGGAGCGTCGATCGGCAAGAAAGATGTACGTTGACGCCGGAGATTGTGCTTCAGCAAGAAGCTTGGTCAGTCACGGTG
CAGACAATAACGCAGTGCTTGCGGCATATTTGTCGCTGCTTAGAGAGATGGCTGGACTCCACTGCATTGGGCAAGTCGCGTTGGTAACTTAGACATCGTG
CGTCTTCTTGCCAAGTATGGTGCCAACTTGAATGTTCAAGACCGGTGGGGTACAACCCCATTGATGTTGACGGTCGTCGGTGAAAGCAAGCTCGCAGCAG
AAACCCTGATCGAGCTCGGCGCTTCGGTTGATGCACGAAACGTAGGTACTTTGCATTGTAAGCTTCTGTAGAGGATATTGTTTATCACGCGTTACCATAG
GTGTTTGGACAGTCGCCACTGATGCTCTGTGCTGAAGGAGGAACACCTCTACACCAACTAGGCATGGTATTCCTGCACGCTGGCTCAGATCTCACCTTAC
AAGATGTACGTGCAAGGACTCACAGCAAAATTCTGAAAACATTATTCGGCAGAAATGGTTAAGAGTAAGCGGTCGTTGTGGTACGACAGGCCCAAGGCAT
GACAGCTTTGCACTACGCGGCCACCTGTGGCAACGTAAATCTACTGATGAACATGCTACAGCAGTGCGATGCCGAGCTGGCGGATAAACCGAACAAGGTA
AACTCAACAAAATCTTGAAGTTATCATCAAACATGCCCGCTAACCCAAGACAATGCTCGAATAGTTTGGAGAAACGCTCTCTTACCTCGCTTTTCTGCAC
AAGCATCCACAAATTTTGGAGCTGGTGAAGAATTGGCGAGAAGGAAACCCCATTGTAGCGTTTCACGACAGCGACGAGGAGGGCGACGAAGAAGAAGGTG
GCGCTACAGATACATCTGAGGACGACGATAGCGAAGACGATAGCGACGACCAGGATTAAATGTAGTCCAGATATTGTCCGAAACCCAAACGAGCGTGCAC
AACGAAAACAAAACCTGTGGATCTATAAAGTTTGAGCTATCTCCTCTCTATTGGAGCTTCTCGACAAGTAATTTAGTGCCCTTCTGCTGGTCGACGAGCT
TCTTCAAGTCTCCCATCGCAGGCTTGAGCGCCTTCTTGACGACCTTAGCAGCGTTCTTGGGTCCTTTCTCAGCCTCTAGGAAAGCAAGAACCACGAAAGA
ACCCCGGTTGGTGGAGGCCCACTGCGGAAGCTGACCTTCGACGGCCGAAAGCAGAGGCTCCGCCAGCGAAGTTTCCTTGATCAGACGACGCAAAGCAAAG
TGGCCATTAGCATCAGTGTGAAGCGCCTCCTCCTCCTCGATAGGCTCCGCCAACGCGGCGGCCGCCACACTGTCCGCCAGATCAGAGCTCTGACTTCGCT
TCGCAACTTCAACAATCACGTCACGACCCTCCTTCGAGCGCATCAGGGCAGTGGCATTCTCCACGCACATCTCCTCCAGTTTGGGCAGGAGACCCTTCAG
GAGTTCCTCGCGACGAGCGTCCGGGTCCTTCTTGTAGTTCACCACCAAGACCTTCGGGTCCTCAGGCGACGGAAGCATGGGAGGCTCCAACAGGGCAAGA
TCATCCGGCGAAAGGTACTTCTTGTTCGACGGGCTGAGCAGCTGGAGTAGAACCTTGCGTCCGCTCGGGTGCATCGCCACCGAAAAGAGTTCGTCGTTCA
TCTCCGCCAGAACGGACTTCTGCACAAGAACCGAGTCATCAACGACATCCAGGATGCGCATGATCACAAGGTAACCGCTGGGGTGGTTGCAAGCCTCCAG
CACCTTGTCCTTGAGAGCCTTAATAATGCGTTTACGGTCCTTGGCCGCACCAAGCGACAGGCACTTGTTCACTACACGAGCACCGTTGCGCGTAGCCAGC
AGAGCCAACGAAGCGTCACGCACGTTCGCCACCATTTGCATCACGTCGTCGTGCTCAGCATTGCACAGATATTCCCACAGCAGGGACTGCACGAAGGCCA
AACCAAGAAGCTGCTTGTCGACCATGCGGTTGAGAATGGTGCTCAGATGCTTGAGCACGTCCGCCTTCTTGTCCGGGTGCGCCGCGATGATGTCAGCCAG
GTTGCGTTTGCTCTCCTCGTGGAAGTAGGCGAACTCGCGCCCGTAGAACTCGAGCTTGAGCGCCGTAAGCTGCGACGGCTTGAGATACTCCTGTGCATAC
TCGAGCACATTAGCCGCAATGTTGTGCGTGCCCACCTGCACAACGTGGCCTGAGAGGCACTTGACGATGGCGGCGCGGTCGGACACGCTGCCGTAGCGGA
TCATCTTCTGCACGAGGAAGCATCCGTACTGCATCTTGGCCACCTCAATCAGGTGCTCCTTCATCTCGAGCACAATTTGCGACCGGTGCTCGGGCTTGCC
GTACTGCATGAGCGACTGGATGACGCGCGAGGCGTCGTGCTTCGCCGCCACGTCATAGATCTTGCCCTTCACCAGCGTGTACAGTTCATCCACAAGCGTA
GCACGCTTGCTCTTCTCCACGTCGCGCTCGCGGATGACGTTCCAGATCTGCTTGGCGCGCGTCACCATCTCGTAGTGCGGGCGCTGCATCTTGCGCTGCT
TCTTGGCCAGCTTCTGGTCCATGAACGACTTCTTGCCGTCCTCGCCATTGCCACCGGCCGGGCGCTTCTTGCCACTGAAGCCCTTGGTGAAGCTCTTGGC
CTTGGTGAAGCTCTTGGCCTTGGTGAAGCTCTTGCCCTTGGGCTCCGACGTTTTCGCTTGCACCGCCATAGTCCCTGAGTATGCAGCAATGCCCCGCAGC
CTTTCACGACCAGTGGCCGCCCAACCAGTCAAACTTCGATCAAATGTGGTGTGTGTAGACACCACGTAATGTGGACTACATAATGAACCATGTTGAAGCA
TACCTATGCAAATGCATATTGTATCTTGAAGCGACGCGAGCAATGCACTCGAAGATCTAGTGGCGGCAAGGCGAGAGAGTGCACGATGGCATTGTTTTAC
GACTACAATGTGCAGGTGCCGGCGAATTTGCGACAGGTCTGCTCGGTCTGGGGAGAGCTGGACCCGGTGCTGGCCGTGGCGCTGGAGAACCGAGAGATTC
ACTTCTTCACGGATGAGGTACTGGCAGCAAATAGTTTGGTGGGTAACCAATAGATCCGAAGCATTAACCGGTTGCATGGTCCCTTACTCGATGTAGGGTG
AGAAGCAGCAAGGTCTGGAGAGCTATTCGCGCAGTGCCGACATCGTCTCGATGGCCTGGCAGCCTCGTGGCGGAGCTGTCGCGGTCGGATGGAGCGACGG
TATGTTGGATGCCTTTGAATTAATACTATCAACGCGCACTGAGTCTTGTTGGCTTGTGCGGGCCAGGTATGGTCTCGCTGTGGGTATTCAAGGAACAGTC
GGCGCGCGAAGTGAACTCGCCGCACACGAGCCGCGTGTGTCTGTTGAAGTGGTCCCCGTCAGGGAATCGACTCATGTCTGCGGATGAGAACGGAATATTT
GCCGTGTGGAAGGTGGATAGTCGGTGCCAGCTAACCCTCAGTACGCAATATGCGCGTCAAGGTAGCTTCACTCACTGTGTCTTCGCCACTCGATCAGCGC
CACCAAAGGACAGCCACACCAAAATGTGAGTATATGTTACTTTCCATAATGGTTCTGCTAGCTATTGCGCTAATTTGCCTCGATTTTGATGTCTTTGTGT
TGCTTAGGGAGCATTTTTCTCAGCACGCGTGTCCACAGTTCTTTTTCGGTGGTGAGATGGGGTCTGTACACTATGCCGACGATTTGGGCCACATTTCGGA
CATTCAGGTGCTAAACCACGCAATAGAGTCGATGATGTTTTTCGAGGAGCAAAGCCGCCTCATTGTCATCACACGGGCGGTGCAGCTTATCGTGTATCAA
GTGGGCGTCACGGACGGCACAGTAAAGCCAATTACTAAAGTCAAGCTGAGTCTAGCGGGAGAAGGTTCACTGCTGGAAACAAAGTGGGCTAGTCCGGGGC
TACTAGCAATTGCGTCTGGCGAACCACTTGTGCGGTTCTGGAACATTCGTACTGAAGAGAACAGTGTATTGAGTCTACCAAAGTCAAGTGGACTCAATTA
CAACGTCAACAATTTGAGTTTTTCCCCGCGAAGGCGCGTTCTCGTGGCGGGTACAGCTCAAGGGGCAGTTTTCTTTTGGCGTGCCACGTCTTTCATTGAC
ACGACGCAAGGTACTGGAGACTCCGCAAATGTGTCGTACCGATGGGACTTGCTCTTCACGGCAGAAGTGGGTCGTGCAGTCACACGTATCGGCTGGAGCA
ATGCCCACCCTGCGTTGTACGCCAACACCGTCGAAGGAGTGGTCATTTTACATGAGGGCAACATGCAGCGTGCACTTAGTGGAGATACATCAGTCATTCA
AATCCGACCGAAGACACTCTCAATCGAGAAGTTCCAAGATGGAGCGCAGTCTGGTGTGACAATCACACAGTCGACACTTGAAGCATCGCTATGTGTGAAG
GGTGTTTCCCACGACGGATCAACGCTCGTTGTTTGGAACGGATCAAAAGCAGAAGTGTACGAAATGAAAGATGGAGATGCCAAAGTCACTAATCAGTTCA
AGTGTTTTTCGAGTGCTATGGTGCTTCGCGGTGAATCCATTTATCGGGCAAACGGAAATCATGTCGAGGTTTGTAACCTTGCAGGAGTAGTGAAAAACAC
CATTTCGTTCACGGAAGCCGAAGGCCGGCCGGCGATGCTGTCACTTCAGAACAAGTTTCTTGCTGTGGGTACGGATCGGGGCCTATTGCGCGTATTCGAC
GTATCCCGCCGTGACCCCAAAGCTTTAGGAAGCATGGGAAATCTCCCCGAAGCTTTTGGAGAAGAGACCAAGTCTGCTGTGATGCGAGCAATCTGTGTCA
ACTCGGACGGCACTCGCATCTGCATTCTTGCTGACCGCGTTGAAGGTGCTTTGCTAATGCGAGAACCATTGAACAAGCTTTTCCTGTTTCAAACGGATCT
CAACATTTACCAGCAGTTTGACTTTGGCTCTTCACGCTACCCGACCTCAGCTTTCTTCGATCCTCAAGAGCCACGGTTGCTTATCTGCGAGACTGTCAAG
ACAGGTAATGATAGTGCGTCGACGACATCGGGTGGAGCTGCTGCTGGTCGTACCGACGACGGTTTGGGGACTGGTGGTCCCGGTGGTGCGCGCGGGAACC
AAGTCTCAGACAAGGAGGTCACCATCATTTTTGCGTCAAACGAGCACGGCCTACTGATGCAAGACAGTTTTGACCTTGATCTGAAGTACTCCGCGCTACT
AGGTATTCAAGTTCCACGTGTATATTTCGTGGCAAAGGTGGACAACAGCTCATCAGATGACTCCACAACCGTAGTGCATGTTGGCCGGACCAAGGCTAAC
AACCCCGTCACTAAAACTCCCATGGTTTACGACACCATTAGCTATCTTCGCACACAGATCATGCGCGACTTCACGGGGCTGGATAAGGTCAACAATGAGG
CGAAGCAAGCTCTAATCGACTTTTGCTACTTCATGACGGTCGGTAATATGGATGAAGCGTACCGCTCAGTCAAACTCATTGAAAATCCGTCCGTCTGGGA
GAACATGGCGCGCATGTGCGTGAAGACGAAGCGGCTGGATGTGGCTGAGGTATGTCTCGGGAATATGGGCCATGCTCGAGGTGCGGCTGCAGTGCAAGAG
GCAAAGAGAGAACCTGAGCTCGAAGTTGCGATTGCCATGGTAGCAATTCAACTAGGCCTTCGCGACGATGCAGCCCGTTTGTACCGTGAGTGCGGCCGCT
ACGACCTCCTGAACAAACTCTATCAGGCCAGCGGATACTGGAAAAAGGCTGTTGATGTAGCGGCCAAGCGCGACCGCATTCATCTCAAGACAACTTACCA
CGCACTGGCACGACACTACGAGGAAATGGGAGATCTGAAGGAGGCGATGGAAGCCTACGAGGATGCTGGCACTCATCAAAAGGATATTCCTCGCATGCTA
TTCAAGCTGGGCAAGGTGGACATACTCCAGAAGTACGTAGCAACTTCAAACAACCGCGACCTGCTAATTTGGTGGGCTCAGTTCCAAGAGAGCCAGGGAC
AATTTGATGCTGCCGTAGAAAGCTATCAGCGTGCCAAGGACTACCTGTCCATTGTACGCGTCTTGTGTTTCAAGAAAGACTTCCAGACGGCTGCGAAAGT
AGCACAGACGAGCGGGAATCGCGCAGCAGCGTATCATCTGGCCCGGCAATTCGAGGCGCACAACGAAATTTCCAACGCTATCCATTTCTTCGCAAGCGGT
GGTTGCTACAACCATGCCATTCGTCTGGCCAAGGAGCACCGCATGGACGCCGACCTCATGGGCTTCGCGCTCATGAGCAAGCCCAGTGATATGCTTGATT
GTGCTGCATACTTCGAAGAGCAACATGAAATGGAGAAAGCCGTCCAGCTGTACCACAAAGGAGGAAACGTGGCTAGGGCCCTCGATTTGTGTTTCCAGGC
CCAACTCTTTGAGGAGCTGCATCACCTCACGGACGAACTCAGTGGCTCTGGCAACACTTCGCCCGCTATCTTGAAAAAATGCGCTGACTTCTTCATCGCC
AACGGTCATTTCGCTAAGGCCGTGCACTTGTGCTTGATCGGACATCGCGTTGCAGAGGCTCTGGATGTGTGCATGCAACACGATGTGAAGGTTACTGAAG
AGATGGCGGAGAAGATGACGCCTCCCAAAGGTGATGACACCGCGTCGCCGGCTGACAAGAAGAAGCGCACTGAGCTACTGCTTAAGCTTGCCAAGTGCTG
CAAGCAGCAAGGCTCGTATCACTTGGCCACGAAGAAGTACACTCAAGCCGGCAACAAGCTTAAGGCCATGAAATGTCTGCTCAAGTCCGGCGACACTGAG
AAGGTCGTGTTCTTTGCTAACGTATCGCGCAACGCCCAAATCTTCGTTCTGGCTGCGAACTACTTGCAGAATTTGGATTGGCGCAAGGACCCGGAAATCC
TGAAGAATATCATGGGGTTCTACACTAAAGCACGTGCATTCGAGCAGCTTGCAGCCTTCTATGCCGGTTGTGCTCAGGTGGAAATCGAGGAATATCGCGA
CTACGAGAAGGCAATTTCTGCGTTGCAAGAAGCCGTTCAGGTGGTGTCCAAATCTCGCGCAGACGGCAAGGAAGCACTGCTGAAGCGTTATGAGAAGCGC
ATTCTGCTGATCGAGCAATTCGTCGTCGCCCGACAGCAAGTGAAGCACAACCCGAAAGAGATGATGGACATTGTCACCAAACTGCTGGAGGAACCAGGTA
TTGAGGAGGCTATCCGTGTGGGCGACGCATATGCAATGCTAACAGAAGCGTACTACGAAGAAGGCGAGCTGAACAAGAGCTTTGAGACGATGGAGGAGAT
GAACCGTAAGGGGCTCACAATCAAGACTTACGTCGACCCACGGGTGGTGGAGTCCGTGCAAGCGAAGTTAGGCGTTTCTCTGGGTGACGACCGACGCCGC
AGACCCTCGCCCAGTGACTATAAGCAGTCTGCTTCGTCCAACCGACCCGGTTCGCGTGATGCCAAATCCAGTCGCCCAGAATCGCGTCCTGCCTCGCGTG
AGGCTCCCAGTAGTCGCCCAGGTTCTCGTGAGGCGCAAATGAGTCGTCCAAACTCGCGCGACGACAAGATGGGGCGTCCTGGAGACGATGAGATTGAGGA
CGAAATGGAAGAAGACATCGCCGACGACGAATAAGGTTGGATGGCTGCACAACTTGCGTTTAGCACATGAAACACGAACCACTCTTGCTTAGTATTTTCA
GTTGCACCCACTGGTATCCAGTCGTGAAAATCGGTTAGCGAAGGGGTGCACAAGTGTGACCCGACTCCATGGCTCGCTGGCAGCTCGAGGACCATGCCCA
ACTCTTCACAACCAGGCAACCCACATCCAACAGCGAGCAGCGACTCAATCGCTCAGACTAATGCCGAGATCCCTTCACCAAACGCAGCTTCGACTGTCGA
CACGACTCCTGATAACGTCGAAAATGCTCTCGACCAAAAGCCGGAGCTCAGCCATGACGACTTGCTCAGTACCATGACACCGTACCTGACCTGCCAACGA
TGCAATAGCGTGACGTTCATCGACGTGCTGCGAGTACGGCGCAAGGCAGACCAGTTGGGCGAAAGAGAAGACACGACGTTTCTGTATGAAGAAGTACCGA
AATGCCCAGGGTGTGGCAGCACTCGGTATCTACGCGCAGGGGTCGTGAGCTTCCAGGAACAGATCGAGGAAGAGCGAAATGCCATCAAGGAGTTCGAACG
TCGACGTGTCCCGGCAACTGCACTGCTCCAGCGTATCGCGAGGGGATTTCTGGGACGCCTGGAATTCCGTCGTCGCCTGGTAGCGCGTGATCGATATCTG
CGGAAGATCAATCGAGCGGCCACAAGGATTCAAACCCGGGTACGGGGGATGCAGGCGCGGAGACGAACGGTGATCGAGCGGTGTCTACGGATAATCAGCT
TCATGGCACCGCAGATACTTAGTTACGCTTTAGCGAGTCGACCCAACGAGCCACCGGTCTTCTGGTACACGAACACAGCAGAGCTTAGCGTCTTTTACTG
GAACTACAGAGAATATGTGCGTCGATCAGGTGGCAGGCCGACACTGATAAAGGTGGAGAACAACGTGCTGGAAATCACGAGGCGCGTTCTGCGTCGCGAG
CATGCCCTGGTCAGCCGTATCCAGGCGCACTGGCGAGGACTAACCACGCGCGTGGTATTTCGCGAGTACAAGCGGCAGAAAGGATGGTTGAAAAGTATTC
GGCAGTCTCCAGCTGTGAAGATTCAACGGTTAGTGCGTGGCGATGCAAGTCGCCGTCGTTGTCGAGCGTTGCAGGTGAGCACCAAGTACCCGACTCAACG
TGAAGCTTACCGCCGAGAAATGGCGGCGCGTGAGCAACAGGCGAAGGCCTTAGCCTTCCGTCAACGCCTGATGGCTAAGTACAAGCAGCAATTCCAGATC
AACCGCACCACGCGCATGCTCGTGCCGTCGCTCACCAACACAGCCAAGAAATACGGAATCAACTCTATCGACGAGGACGACGAAGGCGCCTTGGGACCGG
AAACTCACTCGCATATCCAGCACTCACTCAAAAGTAGCAGTAGCAACGATAGAAGTACTGGCGAGTCCAAGGCGTGGAGCGGTACCATGCCGCCTCGGAA
CCCGAACGCTATTCGCTTCGCGCAGATCAAGCGCCAGCTCGAGGGCAAGCGCGGTCGACTTCGCGGCCCTCGAGTCCACATTCTCAAGGCGCAGATGTAC
GCTCCTATAACGGAAGCGTCCACACAGGTCCCCGTGGACGATCGTCAATGTTGAAGTTACATGTACGTTTTGTGTTATGTATTCATCTTTAGGTACAAAT
ACGACTTATACAAACAAATACAACAATACAAATCGATCTGAACAGGTTTTCGCTGGCATTTGCATTCAATTTTGCATTCAACAAGACTGCCAACCAGCAT
CAAGACGATGAGCATCTCGACGGGCGCCACGCAATGCGCGGTGATAGCGTTCGGCTGTAACGACGACGGGCAGCTGGGCACGGGTGCCAAGCGCCGACCG
ACGCTGGCGCTCGACGACGTGTCGGCCTCCAACTTCCCCAACCAGCTTGACGGTCTGGCGGGCGAGGAGATCATCGCGGTCTCTTGCGGCTCCCGCCACA
CGATGGCGCTCACGGCTGCCGGCACTGTGTATTCGTGGGGATGGGGATCGGTGCGCTCCCCGCCACCTCTTGCGCGCATTGCTCGACGTACTCACTGGAT
GCGCTTTGTGCTTTGTGCAGATGGGTCAACTGGGCCACGGAGACCTCAAGAGTATTAATGAGCCGCAGAAGATCGCTTTCTTTGAGCTGGATGGACTCGT
GGTGGATTATATCTCGTGTGGAGGCTGCCACTCTGCTGCTGTGACCAATGACGGGACGCTGTACATGTGGGGCGAGTCGCATTGGGGACAGTTGGGTCTG
CCCAAGGAGTTCGAGGCGGCGCACGAGTCGCTGCCGGTCAAGTGCCCGATGCCGGAAGGCAATGCAAACGAAAAGATCCTAAAAATCAGCTGCGGCGGGA
CGCACACGGCTGCGTTGACCAGCTTGGGGCGCGTCTACGTCTGGGGTCGAGGTGATAGCGGCCAACTGGGCATCGGGGCTGCGTGGCTGAAGGACACGGA
GGACGAGGGACTTCTGGGAGTCAGCCGACCACGATTGCTTGAAGGTTTTAACGGCGAGAAGGTCGTGCAAGTCGCTTGCGGTGCTTTCCACTCGGCTGCT
GTGACCGAGGAAGGGCACGTGTACATTTGGGGAAAAGAGGACTACGGGATGCTTGGCGTTGGCCAGACGTCCGATCAGCAGACGCCCAAAAGAGTCGAGT
TTTTCGATGCCATTCCGGCACTGTAAGCTGCTTGTCTTGTCGCTTACCTATGTGCGGATTTTAATATGCTAACGATTGTTGTGTTCTTCGGGACTGTACA
GGCGTGTGTCATGTGGTGGTTGGCACACTACGGTGGTGGCCAAGTCGGGAGACTGCTATGCTTTCGGGCGTGGCGAGTATGGCCGACTCGGTCTTGGCGA
CACAAAGAGTCGAACGCGACCTCACTTGGTACGGAGCGCTGGTTGCTTGAGTATTGCAATCATTGTTGACGTCTCGATGTTTCTACCTCAACAGGTGAAG
GCGTTGAAGGGCAAAACGGTGATTCAAGCTGCATGTGGTGGCTCTCACACTCTGTTCGTCACGAGCGACGGCATTGCCTACGTCGCGGGACGACCCGAGT
ACGTTGTTCAGCCGAGTTGGCTTGACAAGGAGGAAACGCTAATCTCGCCCTGTTTTTCTTGACTCTTGCAGCCACGGACGACTGGGTTTGACGGATATGA
AGCCGCTCGCCGTGCCTACGCGTCTAGACCTTGGTCCGATCCCTGTCCGCCAGGTCTCCGCAGGCGGGGCGCACTCGACGGCGCTGATGCACACTTCTCG
CCCCATCTTTTCGCCCATGATCTCGCCGATCCCCACCAGCAAACCCGTCCCTCACAGCGAACTATAAATGTGTTGCTTCATCGAGGACTATGCAGTGACC
AGCAAAGATCGCTACTCGCAGCACAAGAAGCTTAGACAGGAACGGCCTTGCAACAGCTAGACAATCAATTCGATGCACAGCAAAAAGCTGCAATTTTGAC
AAAGTCGATACATTGCTTCATATCTGTTTTCAGAAGGCTACCTGATTTGAGAATTTGTTCCCGATACAAATTCACTAATTGTTCACTTAGCGAAATTATT
AATTGTTCAAGGGTTTCAACAGAGATTTTCACTTCGTCACTCAAATCTTGGACCGCAACGATCAATGAGCGGCACCGCGAGCTCGTCGTCCAGCACTCAC
TCCCGGGGCCGCAGTGCTTCCCCCGCTTGGTCTCCCACGCAAAGTAGCCAGCGATGTTCCCGCCGTAGTGTCGTGCGCACCACAGAGAAATCTGTCGTGT
TCCGAGTGCGCACACAGGAGCAAATATCGAGCGGTCGAGGGACAAGCAATGGCAGTTCCCAGCACAAGACGCTGTACTTGACGCAGAGCGAAAACACGCG
TGGCACCGACGACGCGGAAGTCCACGAGATACTGACGGAACTGTATGGGGAGGTGGAGCGCAAGAAGCAGTGGCTCAGCAGAGAAGAGCAGACGTTCCAG
CGCGGCCAGGACCGACTCGACAGCTTGCAGCGAGAACATGATGCGCTGCTACGCAATCTGGACCAGTGCGAACGCCGCAGAAAAGAGCGCGTCCGTATCC
AGAAGATGCTGCGCGGGCCTCAAGCTGAGAGTGAGGACTATGACAGCGACGTGGGCGGCAGCAGCAGCGAAAGCGACTGCAGCAGCCACAAACAGCACCG
ACGTCGGAGCGGCAGTCACCACCGCCGACCTCGACGAGATGGGGCCAAGAAGGAGCGCAAGAGGCTGCGTCGCTTCCAGAGTGACGTGTCACTTCGCTTC
CAACTGCTGCAATCTGAGTGTCAACGCAGCGACTTGCAAGTGGAAAAGCTAATGGTCGATCTGCGACGCGAGTACGCCGACTCGTGTCTGTTTGGCAACT
CGTTGAACTTCTAGGAAGGTCCGTTCCTGGTCAGGTTGCTGTATCAGTCCAAATTTCTATTATCCTCCAATCAAACGCCTTCCCTCTCAAAAACTGCTTC
AAATCAAAACGTTCGACAATTTCTGCCGGAGGAATCTGAGCCCTCATGTGGTCTGCGGACTCGGGCGCCAACGACGAGGACCCGCGCGAGATCCAGCGCC
GAAGAGAGGCCTACGCGCGGGAGCTGGACCACCAGATCGCGCTGCGTCGCGCACGCCAGCACCAGGAGCAGATGGAGCGCGAGGAGCTGGAGCGCAAGCT
GGCGCCGAGCGAGCGTTCGCCGGCCAAGTGGCTGGTCGAAGGCGGCCATTTCGAGCTGCCAGCGGCCTCCCAGTCGCCCTGGAAGTTCGAGCAGAGCGTG
GAACTGCACGACGAGCAACGACAAGACCGCGGTGCCGCGACGGGGGAAGCCAACAGCGTTTCGTCGTCCCACCCGCGCTTCCGAGTGACAGACGAGAGCG
AGACCAGTCAGAGGCTGCGAGAACGCGCACAGCAGATGCAGTGGAAGAGGATGCTGGATGAACAGGTGCAGGAGAAGGCGCGGCTGAAGGAGTTGCAGCA
GGCGGAGCGGCGACGCGGCGAGGAGGACGCGGCGAGGGAAGAGATGCGCTTCCTCCGAGAGCAGCAGCTGCGAGCGCAGCGGAAACTGGGGCATTTCTCA
CCGGTGGTGAATGCTCAGCTGAACGACAATAGGGCAGAGATGAACTCTCCGTACCCTCAGACGCTGCCGCCACCGCCAGATCTGACGGATCGACAGAGGA
ACGACTTTCAACCGACTGCAAGCAGTCGTCACAATTTTGCATTCGACAGAGACCCACGGGAAGAAGACAAGGCGGTATATTATCAGAGAGACCGTCATTA
TGGGAGCACGGGCCCTGCAGAAACACTGCTGCCTCCTCCTGCTCCTTCGCGGATTCAGATGCAACTAGGTATCGAGCGGAGTAGTGCGAATGATGGCGGA
CGCGACACCTTTGATCGAAGCCCGGCCAATGGCATAGTAGGGAGACATTTATATCCTCAAGAGAACGACGCTCAGGAGTCACGCCAGCAACTGGAGCAGC
AGAGCCGTATGATTGATGAGTACCGCTCGCTGCTGGTAGAAATTCGCCGTGAACGAGAGGAGCTGCGGAGAGAACGGGATGAGGTTCGATGCGAGAAAGA
GGAACTGCGTGTGCAACGGGCGTTGCTGCAACTTGAGAACGAGAAAATGGCTAGTCTTGTTGATGCACAACGAGCCCTTAACGAGCAACACCACACGGAC
CTCCAGACCCAGCAGGCTCGACAAACCCTGCAGCAAGCTCAGCAACAGGATCAGTACCAGGCTGTTTCGTATCAGCATCGACTGGCACCAGTTCAGTCTG
TCGGATTTGAATCGAATATTGCGCGTGGTGGTATTGCACTTCCGGATCGGTCAGCCGATGTTCCCGAAGCGCAGACGTTCTCACGGTTGAATCAGCTTCG
CGAGACCCTAGGAGAATTGAATATTCAGGACGACCAAGCTCACCCCGCAGTGCAAGGGCGACGAAGAAAGCCACCAAGTCCGATGTCCATGGCCGACTTT
TCAGCGCCAACACCGGACAAACGTATGACAGTCAATGCTATGGAGTCTCCTCGCTTTCAGCGATTGTCCCGATATCGGCCGATTCCTGCAGTCCCAGCGT
GCGACGAAAGTGTGCTAAACCAGTCTTTGGTTGGTGAAAGCGTCTTCGTTCCCTTGAGCCCTAAGTCGCAAAATCAAAACAATAACGGACCAGCACCGCG
CGCTACTGCCTCTCCGACCGCAGCGGACAGACGTGGTGATAACGACAACCGCCGTGCGAATCCTCTACGAAGCAGCCGCGTCATCAAAAGCCGCGGCTTC
TATGACTTTGAGCAGGAAACAAAGAGCGATAACAAGGTGGATTCGTTCGCGAGTGAATCGGTCAGCGGACGGGACAGTTTTGGCTCGGACCTCGGAAGCA
GCTTCTACGGCGAAGGAGGTGAAAGTGACGCTGAAGACGAGTTGGACGAGCTGGACAGTCATAACGGCGACGAGCGTGTAGCAGCCAGCAGTGGTCTGTT
CCAGGTGCAAGTTCTGGTCTGAACTGTAGCGACGAACCTGTAGTAACAATAGTGCATTTCTCGAGCAAAATAGTATCGATCTGTTGCGCGCGTCACAGGT
TTGATGTTTATGTGGTCCACATTTATAGCATTTAGTTCAGCGCTAGCATTTGGTTGGCGTCGACCATCACCAGAGTCGAAGATGGCGTTCCAGTTCCCCG
TGGCGAGCGGTAAGAAGAAGAAAGTGCAGGTGTTCGAGTGCCCCACCGAGACGTGGAAGGAGCGCAAGCCCCGCGTGAACAAGGTTCGTGCTTGAATCGG
TTGTTTCGATATGGATTCGACTTTGACACTCTCCTTTGCCGCAGAGCAAAGCCAAAGAAGAGGAACCTGAGTTGTCATTGCGCCAGGAGATCCGCAAGGA
GTTCGATGACACGTTCGACTTGGTGCTGGAGTTCGGTGCGTTACTGTCTTGCAGCTTTCAGAGCTTAGAACAATGGGATTAGAGCCACTTACGGAATTTC
GATTTTGGTGCCTGGCGTTGACGGTGGCAGCCAGCTCAAGCTTAAAGGGAAAAGAGAAGAAGGCGCACGAGGCCAAGAAAATCGAGGCATTGGGTGGCAA
AGCGGCGAAGAACCGCAGCGTGCCCTACAAGGTGCTTATCGGATTGAAGACGAAGGGCGTGGCTCGCAAGCAACGTCGCGAGGAGCTGGTACGTCTTGTG
GTTGAGGTGTTTTGTGATTGTTGTCGGTTGTAGCATGTTCACTCTTGCTACTATTGCTGTTGCTTTCGCTGTACGACCACTCAGTTGAAGGAGTCGGACG
TGGTGACAGGGAAGCGGAAATCGAGCGGCGACTCGAGAGACCACCAAAAGCGAAAGAAGGTCGACTATGGCGTGCAGGCTACCAAGGGGCGATTCAAGAG
AGGCGTGTTGGATGTGCGCGGCCTGTAATCTATTGTACACGTTGTAATCCAGCCGACATTTTGTTCCAACCCTTCCACGAGCATCCAAATCGCTCACCAA
CGCTAGCTCTCATTAGTTTAGCCGCTACACTTTAGCGTACTTCTGCATGACAGTAAAGTCTACTTGGCTATATAGAGGTCTACCCAGTGGATAGACCTCC
ATGGGCAGTGCTCGGCGCGCAAGTAAGTTCGAAGTTACCGTGCTCAAGCTTCAACACCGGTACCGTGTACCACTCTACAATTGGATCTTTTCCAGAAGCT
TTGACCACGAAGATGGCGGAGCACAAGACGAGATTTAGTAAGGGCGTCGAAATGCTTGCACTGACAAGATGACCAAACTATTTTATTGTGAATTTACGTG
CCTTCATCGTAGCATTTTCCTTTTTTGATGCGGCGCATACGGATGGCTACGTTGCCCCTGCGAACGAATCAAAGAAGGTGGCGCGCTGTGGGGACCAAGC
GAATTCCCACAACGGAGGTGGATTCTTCGCCGACGAAGAGGAAGACGAGTAGGCGACGCAGTTTATCACTCTCGCAAGTGCTAATTGCATTGACGGAGAA
TGTGTCGTCAGAGACATTGTGACCAAGATCCACCACTGGCAGAATATTACAAAGGACAGCAAGACGAAGCGTCCGCAGATGCGCCGAGAGCCACACGACC
TCTTCTCCAAGACGGAGGTGGGCAGCAATATTAGCTACAATTGACGAGCATTGGTACTTTGGCCTTAGTTTGTGGAGATTGTCGTACTATTAGAAGTCTC
AACCCGAGTCGGATGGTACCGTTCCTGCAGCCAGCGATATCCAGCTGAATCGCCTCCTGTACGTCGAGGCATACAAGAAGCGACATTGAACAGCGGCACT
AACATGGTGATGTTCGCGTCTGAAGAGATGACTACATGCTTGGGGAAAAGGGAGATCAAATCATGCAGCAGATGGAAGACCTGACGACGGATGATCCGCC
GTCACCAGTGTTAAAGTCGCAAAACGATCTTTTCGGTGCTGACGAGCACAAGCAGGACAAGGACAAGCAGGTACGTTGGTCATGTGGATGACAACTGCGC
ACAAGTGGTTAACTTAATGAGCGCCATTTGCTGATAAAAGGACCCCGCTGAACTATCGCTGGATCCGGACGCCATGATGTCGATGGAAGACTTCGAGAAG
TACATCGCTGATAACTAAATATGCTAATGTATTAATGTTGGGCGAAAACATTCCACAACGAATAGATAAAAGTATTCACCAAAGCACGGCGCAGAAGACA
GCACATCACAGCTACACCCACTCGTACAAAGCTATCAGCGAAGAGCGTGAGCGATTGCGGTGCACGACTTGCTGCTTCCTAATCCACTGGCGGAATCCAA
AGGTTCCATCGCCGCCAACTGACTCGCGAACTTCATTTTCAAGGTCGAGGTCGTCATCAACAACAACACACGAACCGCGATCGCTCAATGGAATCGCATC
TGCTTCACGCGGCTCGACCTCCAATGACCGAGCATATCGACTCTCCTCCGACGAATACGGCATTGAAACGTGCAACAGTTTCTGCAAAAGAGTTACATAC
GCAGGTTAGACGTGATATCCACAGCTGAGGATTACGACGACAGGCAAAATTGCTACTCACATCAATACTCTCGTCGTTTTGAAGAGTGTACGCAACAGAC
TGGCGGTGCAAGATTTCCATTGCCAACTCGCCCATTTTTCGTAGCCGACTCGCATTGACTTGACCCTCTTTGCCAAACGCAGGCAACTCGTTCAGTCCGA
CGAAGCCCTAAATCAACACGCACAATGTCAGACATTTTCGTCCGAAGGCATCACTTTGAAATGCGCGTCTTTACCTGGAGATACAACCCAATATAAGGCA
TACTGGGGTTGACAGTTTTGCGCATCAACCGGTTCATCTCGCGACATCCTTTGTCGGAAAGTAGCTGCATTTCGTTCATCATCTTCTTCGCTTCCGCACT
TAGCTGTAATGCACCACCAAATCAGAATTCGTGACTTCGTGCCCACGAGAGGAACATAGCTGGTAATAACGTACACAATCGATCGACTTTCTAAGCCGTT
GTACCGCAGTAGATTGCAATGCGTATAAGATCGAAGCCAGCGTATCATGATTGTGTAATGACACGCAATAATCGGCGGCCTGATCATAGTTCGAAATCAA
AGGTTAGCATGCAGCCCACCAGAGGTCAAACGAGCCGAAATATCCTTTTTACCTTGAGATAAAACGAAATTACTTCGGCACGCTCTTCTGGGGAGTTTTG
TACAAGAACAGCGTTGATCACGTACGCAGAGATCTACACAATATTACCACGGACAAAAACGCCCGAAAGTTAATCTCTTTAGCACGTAAATATAAAGCGA
CAACAGAACGTACGTGCTGAAACCATCGTTTGATACTCGTAAATTCAACGGAGTGCTGCTTTTTCGAGCCTGTCAAAATCAAATCTTGGACTGCATTTTA
GAGACAGCAAAGTTTAGTCAACCCTCCAATTAAACAAGCAGACGATAACATCCCACCTGGAATCTGGCAAAAGACTGCGTGCGTCAGAAGCGTGCACTGT
TCAGCCCACCGTTCTGCATCAATATACCTGAGATATTACCCAACGAAAGAGGACCGAAATCCATAGGTCAGATATGTTCGATCAAAAGGGAGACAATGAG
CTATCACTCGACTTACCGGTGCAAATGAAGCGGAAAGGGCTCGTTGGATACGAACTCAATGCCTGACTCCAAGCCGTATATCTTAGTCATCATTTCTGGA
ATCCTTTCGTAAGTTGTGGCGTAGTTTCCAGCTCCTCGCAATGAGAAATATTCCCTATAAAGGGAGGTATACTCATCAACAAGAGGTACCAACTTTTCCC
TAGGGACGTCAATGTTGTGACTGATCAGGCTGTAGAAGCGATCAGACAGATCATCTACTTCCTTCGTTTCCGTATTTCTAAAAAGCAGGATCATGATGAA
GAGACGGATAAGTCCGTGGCCTATACGAACAATACAAATGGGTAAATGCCACGTTAGTGTCTAATGTAGGTGCATATTGACCGCGCGAAGGATTAACAAA
CAAGCACGCACAAAACTTACTTTTAATCCCGTTTCGGACATGCTCGCTCAACCGATCCACCAATTCGTTAAGACTCGAGAAGCTGTCCAAGAAGAGCACG
AACGCCACCACATCCACCAAGTCCACTTCCGTGCCTGCAACTAACTTGCGAATCAAATCCTCGACAGAACCCGAGAGTGCAGATCGAGACACGTGGTCGG
TCTTGTCCATGATTTCCCACGAATTGTTCGGCATTTGCGATCCAAAATATTCTGTCGCCTTGCTTACCTCGATCCCATGACTATAATCAACAGGTGAGCA
ACCGAAGATATCGACATCAACGCTATTGCCTGCTCGGTTCAACGATCCCAACTTTCGAAGTAGACCCATGACATGAGAATCTCGCGAGATGTTTGCCAGG
TGAGAAGCCTGGCGACCAAAGAGATCACGTTTGTCCAACCGGCAACCGGCACATGTTAAAATCTCCAGACACAGGATTCGGGCATCGCCACCTCCACCAG
GAGCAGACGCAAGTAGGACTGTGGCCGGAGTCTGACCATACCGATTCTGAACATTGGGGTTTGCACCGCTCTGTAGGAGCCGGAGGATTATATCAGCGTG
GGGGAGAGCGGCTGCCATATGCAAACTTGTGTTTCCGTCCAGCGTAGGCATATTTGGATTTGCCCCCTTTGAAAGGCACAACTCTACCAGCTCTGTTCGT
TCACTCTTCACTGCAAACTCCAGAGCCGAAAATCCATTCGACCATGCAACACGGCGAACATCTGCTCCAAGTGCTACAAGCGTCGCGGCACCTTCAAGCG
ATGCTCTAAAGCACATGAACATTAGCGGGGTAAGACCGTGTTTTTCCGCTACGTCAATGTCAGCTCCCGCATCAATAAGGCTCTCAATGATCAACGCCAT
ATCAATCGACTGCTTCACGACATGAAGTGGGCGTCTTCCTTTCTGATTGCACAAGTTCGTATCAGCCCCTCTTGAGATAAGATACTTCACCATAGAGAGT
TGACCGTTATGCACTGCCGCGTGAAGTGGGGATCCCTTCCCAGATACAGGGATGAATCCAAAGACCTGTTTTCCTCGAGATTTTTCCCACGAGCAAAGTT
TATTGAGCTCCACCGTGGACGACCGCAGCCAAGCAGCCGAATCCAAGTCCCCACGGCGCGCTGCAATACACATTAGGTATCGAAACATCTCCGAATCCAG
CGAAAGAAGCTGGTAGTAGTAAAACTCGGTCATGAAAATGAGTTGCTTAGGGAGTGCCGCAGTTCGCACGCGCTGGATAATCTTGTCGAAAGGCATCCCG
ATAACTGGTTCGTGGTTGATGGCAATCAGCGACAATCCAGGGACGATTGAAGCGCTAAGTGCTGCTTGTGATTGCTTTCGCACACTGTAAACAATAGCCC
CTCTACCATTGCCATCGGTCGTAAACTGAATGCCGACATCGTTAGTCGAGATAGATACCGACACGCGAGACCCTGCTAGCGCTAAAGAATCAAACTGATA
GCTTTCATCGCCAGTCTCGAAGCACTCCACCCATTTGATCCCATCGAGGAAAGCTGAAACGACGTTTGCTTTGTTCTGACACGCTGGGTGGTGCTGGTAT
CCGTACTTGAGAAGCGCTCACAGAATCGGTAAATCGCTCAGTGACGACATTGTAACTACGTACCGAAAAACCGCCGTCAGCGTCTCATCTGATACCTCGA
ACAGGTCGCCGTTATATTGAGCAATAGACTCCGTGATGGCCTTTCCAGCTGATAAAATGACCTCGAACTTGTGCGTTGGGAGCGACACGCATTCGAGCAT
GTTAATCACATTGATGGCTAGCTTCCAGTCGCAAACGGATAAATCCTTCGAGATGCCAAAATCTGCCTGAGTTTTCCGCCTCAGCACCTTGAGGTTCTGC
TCGAGGTTGCTGCGCCTCGTCTTGACCTTGTCCGTCTCCAAGCTCGCGTACGCCTCCGCATACAACGGAATAAACACTCGATCTTCCACATGTCGACGAA
TCAGCCGTACCAGGTCATTACCAGGCAGCAGCTCAATCTCTGGGTCCTGATAGAGCTCCAAATGATGACCATCAATGATCGCGTCGTCCAGCTCGACAAT
AAAATTGTGAATTGCTGCGTACGAATGGTCGTGCTCGTTCACCTTGAACTGCACCAAACTCTTGGCGATCTGCTTATCTGTGATGAAAATCTTGTTCAAG
TGTCTCGTGACCGCGTTGGAGCCCGCCTTCTCCTCAGTGGCCGTTAGATCCGTCTCGTAACAGGGCGGGGTCACTCTCCGCACCGAGCGCAGCGCTGCGA
CCCACAGCTCGGCCTCAAACTGGCTGCAGCAATAACACAGCAGCTTGTAAAACCCCTTCTCTATCTGGAATACGTAGGCCTTGTCCGCCACGCGGACGTC
CACGTGTTGCACGGACACGACGCCGTCATTGAGCTGCATGCAGCCCTTGATTTTCTTGCGGCCCTTGTTCTTGTAGTAGGCGAACGTTCCGTCCGAGAAG
AGCACAAAAAAGCGCGTCTTCCAGCTCTTCCACATGTGGCCCTGCTTGGTGAGCCAGCCCATCTTGACGAAGTTGCCTACCTGCACCTGCGTGGCGTAGA
ACGCGTCGTTCAGCAGCGGGTCCGAGCCGTGGCGCACGAGGCGGAAGGCCTTTTCTCGCTGCACGAGCGTCTGCGGGGCGTCCGAGGACGATCGCGACGT
GCGTGACTTGCTGCGACCACCGAACATGGCGGCCAGGAGGCTGCGGCGCTCGTCGCGGTCGCGCTGGTCGGCGAGCGCCTCCACCTCGAGCTCCGCCTGC
TGCGCTTGGGCTCTCGCTTGGCTCTGGGCGCGCGTGCTGCGGCGTGAAAAGTGTGAGCGCTTGGAAGCTTTGGGCGCGGCTTCTTCTAGTAGCGGCGGCG
GCGACGGCAGGTCCCACGGATCGTGCGGATGCTGGCGCCAAGCTGAAGCCATCGATCGAGGCGGCAGAAACTAAACTGGGACTTGGCACCTGCTTGTATT
TTTCGGACAACGTCAAGGTCGCCAGCCGGTTTAATTGGCATAGGGTATTATGGGACGGAGACGGGGTCGGATGTGGCGGTGTATGCGGAGATGCACATGG
TATTACGGACCACAATATCCAGCCTACACTTTTTCTCTTGCGTTGGACTTTGGATGCGTTGCGTGCGAGTTGGAGCTGTTGCTGTGGGGCAAGTGTACCT
ATCCTGAGTGCAACCTGTCCTCGGCAATGGACTTGTTGGCAATAACGCCCTGAAACCGTGCGAGTGTCGACGCCGCACATGACGAGAGCCCGACACTGCG
TGCAAACGGACGTGGTGACGACAAGGGACGGAACACGAATAGGCGACTGCGGGGTTGGCCAAGTCGGACAGGTTCCGGCGCTCGACTGTACCAGCAACAA
CTATTCTCCCCAGCTGATGAGTCAGCCCAGCATTTGCAGCGAACAAGACGAACTCGACCGACTCCGCTGTCCAGGGGTAAATTTGCTTCCTTCATCATCT
TGCGGGGCTTCCGACAGTATCCCATGCCAATTTTTTTACTTGTTGAAGGGAGTCCATTGCAGAGAAAAACGAAGCCATGTCGTAAAATAATGTGGTGTAC
GCCACACACCAGAGATACTTGCCTTTTTTGCGGCTCAAATCGCTGCTCATGTGGGCTGCTCGCCGTAGGTCCTTGGCGACGGCCGAGCGGCGCCTGTCGT
CGTCCCAGGCGGTACGCGCCGCCCCCTGCGCCTTGCGTTCTGTGTTGTGGGCGCCCACGGAGAAGGAGGCGCCGTCAGACGCCGCGGTTCTCAGCCACCA
GCTGCTGGTGCGCGGCGGCTTCGTGCGCAAAAGCGGCCACGGCCTCTTCGCGCTGCTGCCGCTCGGCCGCCTTGTTGTAGCCAAACTGGAGGCGCTCATC
GATGACGAGATGCACAAAATTGGTGGCAACCGCGTGGACCTGGCTGTGCTAACGCCTCACGAGCTATGGAAGCAGTCGGGGCGCTGGCAGAGCCGCGGCC
CGGAGCTCATGGCGCTCGAGGACCGCCGAGAAGACGTGTTGGTGCTCGGACCCACTCACGAGGAGAGCGTCACGAGCCTCGTGGCAGCGCATTACTCAGC
TGCGGGCGCTGTAGACGCGTCGCTCCGACTGTACCAGATCGGCCGCAAGTTTCGCGACGAAATTCGACCGAGATTTGGTCTGTTGAGAGCGAGAGAGTTT
GTGATGAAGGACATGTACTCCTTTGACGCCTCGTACGACGGTGCGTTGCAGACGTACCAGGACGTCACTGCGGCGTACAACCAGATCTTGGTCTCGAGAC
TCAAGCTGCCGGTCAAGCGCGTGGAGGCCGACTCGGGGAATATCGGTGGCAATCTCTCACACGAGTTCCACGTGCTGGCTGGTATCGGCGAAGACGCGAT
TCTGTCGTGTTCGTCGGCAGAGTGTGACTATGCGGCGAATGTGGAGAAAGCGCAGGGGCTTTTGCCATCTTCGGAGCAGACGGTAAATGGCGAGGTCTCG
ACAGAGCTTGGCGCCATCATTGCGCAGCTCGAGGAACAGGCTCGAACTGGAGACGAGAAGGTCTGGAAGACTGTGATGGACCTTCAGGAGGCAGCAGAGG
ACCACGGGTTTTCGGTTAAGCTGGTTCAGGAGCAGGTGGAGAGCTGTGACTCTGAGGCTTTCGATGACGAGGAGGAAGATAAGTCTCTTCCCCGGTGGGC
TCTTTGCTTTGCTCGACACGACAGGGAGGTAAATGAGCTTGCAATCAAGCCGTTTATTGGTGGTGACGAAGGCGAAGTGATCAAGGACACAAGGAAGATC
GCTGAGCTACTGGGCGGGCATTTTCCCACTGTGGAGCTGCATGTGCTCCTGGATGATTCACTGAAGCATAATGAGCACGCTACCCGTGCCGTGAAAGCTC
TTTGTGCGGCTGTCGAGGCCCTGCCACAGCAACAGACGCGTACCCACGCTGTGTGGGGCCAATTTCGCTTGGCTCAGGCGGGTGACCACTGCCCGCGCTG
CAATGGCGGCGACGCTGCAGTGCTCGAGGACAAGCGCGGTATCGAGGTAGGCCACGTTTTCTACCTGGGCCAAAAGTACTCGAAGCCATTCGGAGCGACG
TACACAGACGCCAAGAACAAGAAGCACCCGCTAGAGATGGGTTGCTACGGCCTTGGTGTTAGCCGGCTTGTGGCCGCAGCAGTGGAGGCCTCCCACGATG
ACCGCGGCATCGCGTGGCCCACCGAGATCGCTCCGTTCAAGGTCCTCGTCATGTCCATCGGTGGGAAGAAGCAGGAAGACCCCGTGTCCCAGGCTGCATG
GGATATCGCTGACCAACTAGCTTCTGGCAAGGTGACCGGCCTGGTCAGGGACGACGTGTTGCTGGATGACCGCTGGCGTGAAAGCCCGGGTTCTAAGCTT
GCCGAGTCCGAGCTTATCGGGTACCCGTATCGTGTCGTAGTTGGCAAGCGCTTCGTGAAGGAAGGCCTCGTTGAGGTACAGACACGAGCAACGATGGAGA
AAACGTTCCTGCCACTGGACAAACTGCCAGCTTATTTTGACGGACTTATTCAAGCTGGCAAGTTCTAG