Description :
From Genome Similarity Track
Location :
scaffold_21:171557- 173896
Transcript NameFunction/comments
Plaha_PHALS_10242hypothetical protein

Sequence
2339 bases(100 bases per row)
TTGATCCGGCAAGACTCACATGCGATCACACGTTTGAGTCCGTTGGCACCTGGTCGGAGTGAAACGTTACCAATAGCAACGACCGACATGTCACAGAAGA
CACGAAGTGGATGATCTGGATTTGTGACAACCTTAATCGTGGCACTCATGAGACTTCTTTTGCCGCGCTCAGGAATCATTAGATTTTCATTGGAGTAAAA
TTAGTGAAGGGCCGTTTCATGTCAGCATAATTTATTCAATACGTGTACGGGTAGTTGGCTCGGTCGAGTCATTTTTTTTCGGTTCTTTATTTGTGACAGT
GGCGCCGAACAGGCTTGCGTTATTTGGTCGCAGATTAGCTCCTCAACGCCgaaaacaatttttcaaCAACAGTGAACAGCTTATCTCAGTGCATACACTC
CTACACAATTCTCGATCTTGAAATGCGTTTTTCCCGATTCTCGATCTTTAGATGCGTTTTTCCCGACATCCCATACTTCCCACAAATtcgtcaaaaaaat
atttcatcGAAGTAAGTTTGTTTGTGCATAGGATCTGAACAGTTGCGTCATTGGACAATTAGCGCCGTTAATATCTCAGAGAGACCCTGTGCATATCCAG
CCACTCCCTGATAATTTCGCACGGAGTACTAATTACAGTGTGAGACATGTGGTAGCTTCTAATCAGCAGCCAAAACCCCCACCAATGTGGTCAAGAATTT
CGAACAAAGTGCAGTCGACCGTGCTCATTGTAGTACGccctttctagaaatcggAGTGTGCGCTGAAATTCGAGCTGCATCTAACTTTTTTTTGCATGCA
CAGTTCGTCACTTGTGGTTTGGTTTTTGGACGACGAAGCTGACACCGAGTCAAATCTTGACGCATCCCCCACCCGATGACAACACAAGTGGTAAATTTGT
TGTCACCACGTCGTGATATCTTTTAAACAACGGATACAATAGCTCCATAGATTCCCTGAGCATCAATGTTCTAAGCCTCGCATGCAAGGATCTCTAATGA
CAGATCCATACATGGATCGTAGCTCCATCTAAGTACCCGCTCCGTTTTGCACTTTACGCACTCATCTTCGAGAATAAGTTTTTTCAGCTCTAAAAGCGCG
TAGCGATGTGACACTAACAACCCTAAAGACAACACGAAATGGCACATTTACAAGAGGCTAGTACCAAAAGAATGTGTTTTGCTGCTCTGTACGATAGGCG
CGTCGCACGGTATTGCTTACTTCTAAAATACTTCTCTTCTTCCGAAGAATGAGTCAATCTAAATGATCCAAAGCCTGAATTCTCAACTTGCAGGTTACAA
TTAGGCGCAAAAGACTCTAGTTCCCACCTTGAGTACACTATGATAACTCCAAACATCGTTGTTCATTCCTATTTCAGAGGCACGTTGAAGACTACACTTT
ACGATGAGGCCTTTTTTCCTCTGTAATCTTGGCACACTGCCGCTTCAGTATTCCGAGCTTTGTTCAAGACTGCCCAGCAATATCCTTACAACTAATTTTA
ATCAATCTATTTCCTGCACAAGAGTAGGAAGTTTTGCTTTCGAAGCTTCGTGCCCTCGTCAaacgcgcttctgcttcatgATAGAGGTGTCTTCAAGGCT
CGGTGAAACTCTAGCAACAAAAGCTAGCCTCCCATCGCTCATGGGGTTCGAGACGCACCGTACCTTGGAAAGGATCATGTTTTGAACAAGATCTAGGGTG
AGACTAATTGTTTTTCGCTGTCAAAGTATCAAAAGCCCACTCAAGGTCCAACATGctttacaaccttaacgaATATACCCGTAGCAAGACGCACAAATAA
TGTATACGTTCAACATCACGCGAAACACGTGATTGCACCGCACTGTTGAATTATCAATATTCTCCAAAactccacaaattgtgggACGTTGGTCCTGACA
GCCAACAACATTATTTGTTCCTCCAACTCTCACAGATGTAACTTCTTCGGGTATCATGAAGGCCGGAGATTCAAGTCTCCTCTCTCTTGATCTATCACAT
GTAgtgcgctcgaagagcttttacCTTGCGCACCCGAACCAACCTCGTTGCACAGTAGATGTACACCGCATAAATTGCGATACTACAGGCATACAAAGCG
TTACGATGAACGCGGATGGAATGGTCTTGATGCAAGCCGCACCTGTTTAGAGATCATCCATAAAATCAGTAATGGAAATCATATTCATAAGAAGGTCTAT
CGCCATTACCAATAATTGCACCTAAGTGTATTATAACTTTTGTACATTTGTACAAAATTATATTTGCTGAATGTAATTGTACATTCCAAATATTTTATGG
ACGACAATTAGAAAATAAGTGTTCATCAAAGTTCTATTT