Description :
From Genome Similarity Track
Location :
Scaffold_1:1715034- 1716195
Sequence
1161 bases(100 bases per row)
TCATATACAACCCCTTCCTCCGATCAACGGCCTCCCCGTCGATCCGTCATCCCTCTCTCTCACCAAGCTGACCCGATCTCACTCCTCCTCGCGAGACTGC
ATCGCGCTGAATCGGTTCCGGTTCACGCGATCTCGAAGGAACTCGTGCAATAAAGCTCCACAGTTGAGATCAGCTTCGTCGACCCAGTCAGGCTCGTCGT
CACCCTTCCAGTGCACCAGAAATTCTCGATAAGTCCGGTCGTACCGCGTCCTTCGACCCGTCCGCATATCCGTGATCTCCTCTACTTCGTACTCATTCGC
GTCTCGATCTGGGGCCCAGCTGTCCTCCGGAAGTAAGACTTCGTCGAAATCGAGTCGATCCGCTGCGTCCACCGTGAGCGCGATCTGCGGTCGATCGGGG
AAGTCCCTGACCAGCTTCAGCTTCGAAACATGCACGATCGGGAACAGGTGATAGTCCGTACCAGCGATCTGAAGCTTCATCGTATATTCGTTCATCTTCT
CCGCAACACGGAACGGGCCGTGCCACAGGTGGGCCAACTTCCGGGCATACCCCTCTTTCACTCGATCTAGGTACAGCCACACCTAAGATCCAGCTTCGAT
CGAGTGCGGTCGAACTTCTTCATTGTGTCGATCGGCCCGATCCGCGATCGCCTCGCGTAGTCGAGCATTCACCTGACTTGAGCCTGATCGTAGTGCTTCT
GGATCCGATAACGCCACTGTCGAGGATCCCGATCCCGAGTCCGGGTACTACCCAAAGGTATCGTTGCCTCGAGCGTCGATCGAGGATCCCATCCATGCAT
CAGATAAAATGGGGAGTCCCCACGGACCCGATCCTGAGCCGTGTTGATCGCGAAGGTCAATCGCTCTGCGTACTCATCCCAATCCCTCTAATCCAGATCC
TCCACGAACATCTTCAGGGCCCTCGTCGCCGTCTGTACCATTCGCTCTGCAGTTGCCATCGTCGCTCGCTGGCGGATACCCAGGATCTTGTTAAAGGCGC
GGAAGAAGTCAGCCATAAATCCCGGCTCTCGATCGTGCCTGATCACCTCGCTAGCACCAAATCGCCGGAACACACACTCTTCGTAAGATTCGGCGATCGT
CTACGCCGTTCGGGAGGAACTGGCCTTCGCGATCACGTATCCCGTGAACAGATCGACCCAG