Description :
From Genome Similarity Track
Location :
Scaffold_513:17150- 18915
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_513-fgenesh-gene-0.3Copper-transporting ATPase

Sequence
1765 bases(100 bases per row)
TTTTTtGAATCGTCAACGATGCTCCTCACCTTCATCACACTGGGAAAATACATGGAGTCCTTGGCGAAGGGGAAGACTGCGGATGCCCTCGCCGAGCTGG
CCAAGCTTCAGCCGAAGACCGCGCTTCTTATTGTGCCAGGCGAGTCTGACCGCGAGATCCCTATCGAACTGGTCCAGCGAGGCGATCTTCTTCGCGTTGT
TCCTGGTGCCAACATTCCGACCGACGGCGTCAtcAAATCTGGTACAAGTTCTTGTGATGAGTCCATGCTCACTGGTGAGAGCATGCCAGTGTCCAAAGcT
CCCGGCGACTACGTGTTTGGATCAACAATTAACCAGCAGGGtACTCTCGTCATTGAATCGAGCTGCTTCGGTGGTGAGAGCAGCACGCTGGCGCAGATTT
GTAGCTTGATCGAAGAGGCTCAGCTTCACAAGGCTCCGATTCAGGCTCAGGCCGATAAGCTCGCTTCGGTCTTCGCTCCATTCGTGCTGGGAATTTCGTC
TGTCACTTTCCTGTCGTGGTACACTCTTCTCGCGACTGACTCGATTCCAGACCAATACAAGACTGATCTCGGCTTGAACCCGGAGGATGGGCATGCGAAC
GACATGTTCATCTCCGTGCTGTTCGCCATTTCTGTTGTTGTCATTGCGTGTCCGTGTGCACTTGGTCTCGCTACACCAACTGCTGTGATGGTAGGATGTG
GTGTTGGTGCGAAGAAGGGAATTCTCATCAAGGGCGGTCGTGCCCTTGAGATTGCTCGTCACGTCGACACAATtGTTTTCGATAAGACTGGTACTCTGAC
GGTTGGTCATCCATCTGTAACGGATGTTGTGCTTTCCGATCGTGCCTACACCCCACGTGACCTCCTGTACTATGGTGCTTCGCTGGAGTGTGTGAGTGAG
CACGTTTTGGGcAAGGCTATTGTCATTACCGCCACGGAGCAAGAGAAGCTGCAGCTCAATGAGCCCACACAGGTGCATGTTACTCCTGGTCGTGGTATTG
AAGGCCTTGTTCCACCACGCAAGGATACTCTCGGTACAAGCGATGTTCGCGTTATTGTGGGCAACACGGAGTATTTGGAAGAGAAGAACATTGAGGTCAG
CACGAAGATTCGCGATGAAATGCACGACCTTGAGATGGAGGGCAAGACGGTGGTTTGTGTGTGTGTCGAAGACAAGTTGATCGGTAtAaTCGGCCTTGCC
GATACGCCTCGTCCTGAGTCAAAATCGGTGGTTCAGTACCTCAAGAACATGGGCCTTGATGTCTGGCTCATCACTGGTGACAACATCCGTACAGCGAGCG
CCATCGCTCGCCAAATGGGCATTGACCACGTCAAGGCAATTGCCcTTCCAGGAGAGAAAGCGTCTCAGATCAAGGCACTTCAAGagCGCATCTCGCCACT
CACCAAGCGCAACCGCGTTGTGTGTATGGTTGGCGATGGTATCAACGATGCACCAGCACTTGCACAAGCCGATGTGGGTATGGCCATTGGAGCTGGCACG
CAGATTGCCAAGGCGGAGGCCGATATGATCCTCGTCAAGAGCAAGCTGACGGACGTCGTTGTTGCACTCGACCTAGCTCGTGTGGTTTTCAACCGCATCA
TGCTTAACTTCTTCTTTTCCGTCGCGTACAACTTCATCGGGATCCCACTTGCTGCCGGTGCATTTTTCCCGATCATCCACTCGACGATGCCGCCTGCTTG
TGCCGGACTTGCCATGGCGTTTTCGTCCGTCTCGGTCGTCGTgTCCTCGCTCTTGCTTAAGCGTT