Description :
From Genome Similarity Track
Location :
Scaffold_116:1715- 8281
Sequence
6566 bases(100 bases per row)
TGTAATGGGCCCAACTCCAATTACATAAGTAGGTAGGTATTTCTTTAGTTATTACATAAGTAGGTAAAGTGGCACACGGGTAGCGTGTGCCAAGGTGTCA
TCATCTGATTGGTTGATAGTGAGGAACCAGACTCACTTATTGACCAATCAGATAAAGACATGTGTTTGAGTGGTTCACACGAGGCCAGGGGTAGCCGCCG
TGGTCCTAAATAAATCAAAGTTGAATTTGACACAAACCTAAGACTTGGTTTTATTATTGCGAGCTTCCTCCGCACTATAGTGTAAGCTAGTGACGGTATC
TCTTACCCCGTTACACCTGGTAGCACTTAGTAGTACTTCCAACGACCAAGTCTACGATGAGCCAAGTCCAGATCTCCGGGGCGACCCTGGAGCATGCTGC
ATTCCACCATCTCACTCGCGTGGAGTGGGAAGCGCTTCACCGCCTCGTGGCGGTGTTCGGAGACGCTGTCGTCGCATCGCTGCTGAGCTCAGCGACGCCC
GACCAGCAACGTCTTGCAGCACAAGAGTTCATGGAACGCGAGCTCGCCGATGCGAATCGGCGGGTGTCAACTCCCTCGCGTCCATCCCAGAATGACGTCG
TCAAGATGGAGACGTCTACGTATTCTGGCGCCGGTGAAAACCGGCTCCCGCTAAACCGGTGGTTCCGCGAGATCGACATCGCTACCGCCTCGGGACGCAT
CGAGGCGTCATCCGCCAAGATGAACTTCCTCCTCTCCCGGTTAACCGGGAAGGCCAAAGAATAGGCCCTCGGGAAGCTGGTTGTCGACCCCGAGGCTTTC
CCGACTCTGGAAACTCTCCAGAGTGACTTGCGCCTCGCGTTCAAGCCCCCGCAAGATGAGTCTCGCGTTCGCGCAGAGTTCTTCGCTCTGCGGCAAGGGC
AGATGTCCATGCGTGATTACGTCCAGAAGACGCGACATCTGGCGTCATGCATCGTGACCAAGCCAATCGACATGGCCTCGCAAGTCCACGTATTTGTGTT
CGGCATGCGCGAGGGTATGACCCGCTACTGCCTCACCAGAGCTGAGCCCTCCTCTCTCGAGGAGGCGCTTGCACTCACGATTCGCGAGGATTACATAGTC
GCTGCATCGCACGCCGCAGCCATACCTGCGGAAGCCCGAGAGTCTACCCCCGAGCCCATGGAGATCGACGCCATCAACGCGTCGAGCAATCGACGTCGCG
GGTCCTACCGCGGCAGCGCTGGGCGAAGCAATCGCTCCCTCATTTGCTTCCGCTGTGGGAAGAAGGGTCATCGCGCGGCGGAGTGCCGCGCGCCAGCTCC
CGTCGTCTCTCACGTCGACGCGGAACACTCCTCGGTCGCTCATCAAAAAAACGACCAGGACCAGTAGGTGCGGTCCTTCGTTAAAGCCAGTAGGGCGGAG
GGCCCGGTCCTTCGTTAAAGCCAGTAGGGCGCTTCAATTGGCTTTAACGAAGGACCGGGCCCTCCGGTGGCAGCCCAACCTTCGAGCCCTCCCGTGCTCC
AAGCACACACCAATGCCACCACTACGCCGGGCGACTCGAGACTGATCATTGTCAGCCTCCACGTCACCGGTGCCCGGCGACCACTGCGCGCGCTCCTTGA
CTCAGGAGCGACCAACAACTTCTTTCGCGCGTCGTGTTTGTCGGTACTACCCAAGAGCGTCCGCGTCCGGAATGGTCCGGGCGAGGTCCAAGTCAAACTC
GCAGATGGTAAGGCTCGCCGCGTTGCGCGGCGTGACGTGTCTTTGTCGTACACGTTCGACGGCTTCCGTAGCAAGGACGACTTCTTGGTGATCGAAATGA
ACTACGCGTTTGACTGCATCCTGGGCATCCATTGGCTTGCGCGATATCAGCCAGAGATTGACTGGCTGGCCCAATCAGTCAAGCGTCGACGTGGATTCGA
CGTGCGCGAGGTCTTCACACACCTCTTGGTGGCGCCAAGAGACTGGCCCCACGTCACAGTCGTAGACAAAACAGCAACGACACAGGCAGTGCACAGAGCG
AGCGATGGCCCTCTCTGCATGGCTTGTGCTACGTTGTTGGACGAAGAGCCCTCGCGGTTTCGCGAGATAGATGATGAGGTGGTTGAGCAGCGGTTCCCAC
AGTACAAGACGGTGGTCGAGCAGGGGCTCCCACAACACGAGATGATGGTCGAGCAGGGGCTACATTACGAGACAGTGTTCGAGCAGGGGCTCCCACAACA
CGAGATGATGGTCGAGCAGGGGCTACAATACGAGACAGTGGTCGAGCAGGGGCTCCCACACAACGAGACGGCGGTAGATCAGAGGTTCCCGCCGAACGAT
TCGGCGGTCGAGCAGATTGGGCTCCCGTCAAACGATGCCGCGGTTGAGCAGGGGCTCCCGCGTGTTCCCGGCCCGGTCGAGTACGGTCTCCCGCGCCTAG
AGGAGGGTGATGCATCGTCGAGTAGCAGTGCGTCAGACTCGAGCGTAAGCTCGAGGAAGTCGAAGAAGAAGTCGAAGAGACGACACCTGAAACCTCGTCG
AGACTACACGACCAGCGATAGCCCGCCGATGGAATCGGTCAGCGCGCTGGAGTACGTGGAAGGAGGCCCGAATCGGTCGCGCAGCATCGCAATCGCGAGC
CCGCCGCGCGAAGCGGCGGCGATCACACGCCTTCCAGGCTTGTCCTGGAAGAACTTTCTTCGGGACCTCAAGGCTGGAGACGTCGAGCAAGTATGCTTGG
TCACCGAGGCAGTCTCGGTGGATGAGGCAGCAAATGCGGTCGCAACGGACAGTGAACGTTCACGTCCGCTAGGTGCTGAACCTAAGTCTGCTCGATAGGG
AAGATTCCAAACGCAGTCTTGGGAGGCCTTGCGGGAGTCAGCGAATCCCGTATACGACACCGCCTGCGAGTACGCCGACGTCTTCCCGGATGAGATCCCC
GCCAAGCTACCGGCGGATCGTGGGATTCAGCATGAGATCGACCTCGCGCCAGGTACGAAGTACTGCGTTACCAGACAATGGCCACTTCCGCGTGATCAAG
TGAAAGCGATCGATGACTTCTTCGAGGGCCGCCGAAAGGCGGGTCACGTGCGTGAGAGTACCTCTCCCCATTCCAGTCCAACGTTCTGTGTGAAGAAAGC
TACAGAGGGATGGCGTATCGTTCACGCATTCAACAAGTTGAATGATGCCACCATCCCTGCGCAGACTCCGATCCCTCGGAAGGACATGGTACTGGACTCC
ATGGCTGCCAGCGTCATCTACAGCGCCATCGACCTGACCGATGGATTCTATCAGATCCTGATGAGAACATCTAATGTGCCTCTCACCGCCGTAAGTACAC
CGAGCGGGATGCTCTGGGAGTGGCTCGTGATGCCACAGGGCCTCAAGAACGCGCCTGCCACCTTCAATCGCATGGTCTCCCATGTGCTTCGCCCGCTTCG
AGACTTCGCGCCGAGTTACTTCGACGACATCTTCGTGCACAGCCGCGCTGAGGGCAACCTCAGTGCCGTGGACGTACATTTGAAACACCTGAGACAAGTC
TTCCAGGTGATGCGAGAGAACAAGCTCTACGTAAACCTAAAGAAATGTGTCTTCTGCGCACCGGAGATTCCGGTGTTGGGATGCTACGTGAGCAAGAACG
GTGTGCGCGCGGATCCCGAGAAGGTATCGTCTATGTGCTTGGCCAACGCCGACAAGCCCCACTGAGTTGCGTCAGTGGCTTGGCATGGCCAATTACTTGC
ACAAGTACACGAAGAATTACGCTGGGTTGATCCAGCCGCTGTCCTCGCTGCTGAAGAAGGACGTGATCTGGGAGTGGAAATCGGACCACCAAGCTGCATT
CGACTCGGTGAAGAAGAGCTTGGCGTCTGCGCCGATCCTGAAGCTTGCTGATGACTCAAAGCAATTCCACGTCGTCTGCGACGCGAGCGATTTTGCCATC
GGCTGTGCGCTGATGCAGTTCGATGATGACGAACACGAACGCGTTATCAGCTATCAGTCGCGCCAACTGAAGCCAGCCGAGAAGAATTACCCAGTCCACG
ACAAATATCTCCTGGCAATGCGGTACGCTCTGATCAAATCCAGAGTGTACTTGCTCGGTGAACAGTCATTTGCGGTTTACACTGATCACGCATCGCTGCG
GACAGCGATGAAGAGCCCTCACTTGTCGCAACGGATGGCCCGTTGGCTGTCCTTCTTCTCCGAGTACAACTTCGTTGTTCACTACAAGCCGGGCAATAAT
AACATTCTCGCCGACGCGCTGTCTCGCCGTCTGGACTACGATCCCCGTGAAGCGCTAGGACATCATCTCGCTGATGAGGACGACGAATGTGCGGTCTGCG
TGTCGTCAGGCATCAACTTGACGTTGACCACGCCCACGCTCCCGCTGGGCGACAAGATTGCTACAGCGTACGATGATGACCCTATATACGGTTCCATCAT
GAAGCACCTGCGTGCTCCTAGTAGTGACACGCTAAGTGCCCTGTCAAAGACCACGCGGAATCAGATCGATCGATATCGACTGGACGGCAATCTGCTCAAT
TACAGCATCGACAGGTTCGATGGACCTCGAGTCGTCGTCCCTGATCTACGTGCGCGCATAATCCACGAGTATCATGACGCCCCGACTGGAGGACATCTCG
GTCGCGAGAAGACGTACGCGGCTCTGTCGAGAGACTTCAATTGGCCGCACGTGTACAAGTGGGTACGCACGTGGGTCCGCACATGTGAAACTTGCCAGCG
AGTCAAACCGTCTTCGACGTCTCAGGCCCCATTGCGCCCTCTTCCGGTCGCCACGGAAGCCTGGCGCTCCATTTTGATGGACTTCATCTTCGGTCTTCCG
CCCGATACAGCCGGGCGCACGGGTGTACTTGTGTTCGTCGATCGTTTCAGCAAGATGGTCCATCTCGTTCCGGTGGCGGCCTCTATCGCCGCGGAAGAGT
CCGCGTCCCACTTCGTCGACGTGATTTTTCGTCACCACGGTCTGCCGGAGTCTATCGTGTCCGAAAGCGACCCGCGGTTTACATCCGCGTTCTGGTCACG
CCTCTTCGAGCTCTTGGGAACCAAATTGCTGATGTCAACTGCGGCACATCCGGAGACGTATGGACAAACAGAACGCGTCAACCGCGTCCTTGAAGACGTT
CTCCGCAGCTATGCAACTTCGCACACGAGCTAGCTCGTTCCTACCGCTAGCCGAGTTCGCACTCAACAACGCCGAGCACTCCTCGACGGGTATGACGCCG
TTCTTCGTGAACAACGCTCGCCACCCACGTGTTCCGGCACTTCTCGCCGTGGGTCACCCCACGGATGCTGGCGGCTCCACCCTTGGTGGGGGAGAACCTC
CTTCGGTCGACATGGATGCTGAAGCTGCGCTCAGCTCTAGGGACAACGTGTCCGTGTCGTGGTCATCACCGGTACGTGAACCGGTGTCTCAGCACGCACC
GGTAGCCTCACCGGTGTCAACAAGCCTGCCGGCGCACTCGACTTCAGGGTTATCTTCGGGTGTAGCCAGTGCGAACGCCCTGACTCATTCTCCGTCCAAG
CAGTCCATCGAGCCTCCTCGGTATACTGCATCTCCGATAACGAGATGGACGTCGCAGAACTTGATCGATCCAGGCAGCAAGATTCGTGAGCAGGAAGTTA
CCACGGCAAACTATACACCGAAACCCTCGGTGCTTCCTGCCGATCGCTCGGCAGTTGCGGAATTCGTCATGCAAAGGCAATCCATCGCAAGGTTCGTCCG
CGACGCACTGCAGAACGCAGTGGACAAGCAAAAGGAACAAGCTGATAAGCACGGTTGAAAGAACGTGAATGTATTCAAGATAGGAGATCGCGTTCTCCTA
TCGACCGAGGGAATCCGCGCTCCCGCCGTGACCAACCTCGGCGCCAACAAACTTGCCCCACGCTTCATCGGTCATTTTCGTGTAACCAAGGCTGTGGGCG
ACGCCTACACCTTGGACATCCCGTCGTCACTTAGACTCCACCCGACGTTTTACGTCGGGCGACTCAAACGGTACTTCCCTGCGACGATTCCTAATTCGAG
CCAGCAGACGGAGCATGCGTCGGGCGACCAGCCCGACGAGCCTGACGCGCCAGAAAGCCGTCAGCCCTGGCGCCCGCTCTCGCGGACGATCTCCCTGTTG
GGCAGAGCCAAGCACATGCGTCTCCAATTTCCGTAGGCGAGATAACAGCTCCCGATTCGACTGCCGAAGCTCCGACGCGATCTGCTCAGCCCGCCAGGCA
CGATCTTCCGCCCGCTCAGCCCCAACCTGAGCGTCCAACGCACGGCTCGAAGCTGCCTCCACCTCGCCCTGAACGTACAGGGCGTACGCCGTATCATCGT
GAAGGCCCACCACCGATAATTGACTCGGTGGGTGATGCGCGCTGGATTGTGGAGCGTATCGTTGACCACGAAGATCCCCACAGATCGACCGCTAAACGAA
ACGTCCGTAGTCGTGTTCCTCGCGCGGTTCCGACCGCGCGCCGCTACTTGGTACGCTGGCTCGGTTATCCCCCAGAACATGATACGTGGGAGCCCCGCGC
CAACCTTCTCCGCGACGTTCCGGACGTGGTCCACGAGTATGAGACCATGCTGCTTGAGAAGAAGAA