Description :
From Genome Similarity Track
Location :
Scaffold_1840:1715- 3155
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1840-snap-gene-0.3Major Facilitator Superfamily (MFS)

Sequence
1440 bases(100 bases per row)
CCGGCACCATGCGGTAGACGAAGAGGTAGAAGATCGCAAGCGTGCCAATGAACGGCACGAAGCCGTAGTCATTGAGCGCGTCCGCGATGTACGGGTAGCA
GATGCCGATGATCAGGTTCGACGTCCAGTTCCAGCAGATGCAGATGGACGTGGCGGACGCGCGGATTGAATCCGGGAACAGGTCGGCGACCACCACCCAC
ACGAGCGGGCCGAGGCTCACGCCGAACGCCGCGACGTATGTGGCCGTGAACACGATGGACAGCGCCTGCACGCCCGCGACCAGCGAGATGGTCATGCAGA
CGGCGCTGAGCACCATGCCGATCATGCCCGCGAGGATCATCTTGCGATTGCCGTACTTGGTGGCCAGCCAGCCGGAGAAGAAGGTCGGCAGCACGTTCAC
GATGTCGATGATGAGCGTGCCGATGCGGTCGTCCGCGATGCCGGCGTTCTTGAAGATATCGGACGAGTAGAAGAACACGGCGTTAATGCCTGAGAGCTGC
TGTGCGCAGGCGATGCCGACCGCCGTGAGCAACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGAGCAGCGGCGAGAAGAGCAGCGCAACGC
TGGAGGACGCCCCCTTGAGGTCCAGCTCGTCTGGCTGCGCGAGCTCCACGTCGCCGCCCTGCTTTTTCTCCGAGGCTTCGAACCACTCGAGCGCCACGTG
CACGTTCTCCTCGCCGAAGAGACGAGCGAGTTCCTTCTCGGCGTCCTCGCGACGGCCCTTCATGAGCAGCCATGCGGGGCTCTCGACCATGGCGAACGAC
GAAAACACGAGGAAGAGGCCCGCGAGGATGATCGGGAAACCCGCGATGTAGCGCCAGCCCGAGCTCGTGTTGGCGAAGAAGAACGTGAGGCCGACCAGCA
GGATGCCGATCGTGATGGAGATTTGGAAGCCCACGCCCAGAGAGCTGCGCAGGTGCGGCGGCGTGATCTCGTTGATGTAGCCGCCGACCACACCCGTGGC
GCAACCTGACGCGATGCCCGAGAGCACGCGGCCGATGACGAAGACCCAGATGTCGGACACGGTCGCCTGCACGATCGCGCCGGCCACAATGAAGCCGCAG
TTGGCCATCATCACCGTCTTGCGGCCGAACTTGTCGGAGAAGCTGCCGCTGGAGAGACTGCCGATCATGCCGCCGACGATCCAAGCGTTGACTGCGAACG
TCCACTCGAGCTTCGAGNNNNNNNNNNCTCGGGCAGCGGGCGCATCTTGCACTCGTCTGCGTCGTGGAACGTTGTGAGGTTGAGCTGCGAGGTGGACCAG
CCGTACTGCAGCGGTTGTAGCAGCGCCACGAGGATGCTCGTGTAGAGGACCCAGTGGGGCTGCAGCAGTACACGCGGAACGGCAGCAGTGGCCTCGTCGG
CGCCCAGGTGCGACTGTACAATCGACGCGCGTGAGGGTGT