Description :
From Genome Similarity Track
Location :
Scaffold_66:17146- 19512
Sequence
2366 bases(100 bases per row)
TGATAGAATTTAACGATGTATTCCCGAAAGATGTGCCGTACGGTTTACCTAAATAAAAAGGTACTCGTCACGAAATAGACCTGAAATCGGTTTCGAAGTA
CTGTTTCATGAAGTAATGGCCACTGCCTCGTGAACAAGTACTAGCGATCGACAAATTTTTTGCAGATCTCTTAGCAGCCGGTCATGTGAGGGAGTCGACC
TTCTCACATAGCTTTCCGACCTTCTGTGTGCTGAAACCAGAGGAGGTTGGCGGATAGTACATACTTTCAGCAAGTTCAATGCCGCAACTGTACCGTCTCA
AACGCCGATACCAAGGAAATATGTTATCATCGCTGGTATGGCAAAGGGTACCATCTTTGATCAATGGATCTGATGGACGGGTTCTATCAGATCCTATGCG
CGAAGGGACATCCCATATACCACTGTTAGCACCTTAAGTGGTATGCTTTGGGAGTGGATAGTAGTGCCCCAAGGCCTAATTAATGGCCCTGCTACATTCG
ACAGATGTATGACATATCTGTTGGGATCTGTACAAGAATTCGCAGCCAGCTACTTCGATGATGTGTTCGTTCATAGACGGGATATGGAAGGAAAGACGGA
TGTGGAAGTGCACCGACTCCACGTTTGAAAAGCTCTTACACTTATGCGCGAGAATAAGCTATACGCCGACCTCAAGAAGTGTAAATTTGCTGCTTGAGAA
TTACTGCTTCTTGGTTGCATCGTAAGTAAACAAGGCGTCCACAACGATCCGGAAAAGATCATGGCGATCACCGAATGGCCGGTGCCTGTGGATGTAAAGG
ACTTCGAACGTTCCTTGGTCTAGCGGCGTATCTGCACAAATACTCGCACAATTACGCCGAGATGACTGTTTATCTCTCTCGTTTATTGAAAAAGAACGAG
AATTGGGTATGTAGTGATGATTGCCAGTGCTCCTTAGAAGGTATCAAGCAAAGATTGATACGATAGCCAGTTTTGACAATTGCAGATTAAGACAGGCCAT
TTCATGTGGTCTGTGATGCCAGTGACTTTGGGATCGGCTGTGCATTAATGTAGTACGACAAAGATGGTGCGGAGCGTGTCGTCTGCTATCAGTCACTCCA
GCTGCAACCAGATGAACGCAATTATCCTGTCCATGACAAGGAACGCCTTGCCATGAAGTAAGTGTTGGCAAAGTTCAGGGCCTACCTGCTAGGCGATATA
CCCTCTATCGTTGATACGGACCATGCGTCTTACACACGGCCCTAAACAGTCCACACCTCTATGTAGAGGATGGCGAGGTGGCTGTCATTCTTCGCGGAGT
ATAACTTCTTCTTCGAGTATAAGCCAGGATGACTTAATGTCGTCGCTGACGCACTCTTGCGCCGGCCCGATTTTGAACCAGCTGCGCAACCCAACACTGG
TCCGACCACTGTCACGGCACTGACTTCGAGTGACCTGTCGTCAACCTCATTAAAAGGCATACAAAAGGCGGATGATCCGGAGATGGTGCTATTGATTCAT
CATCTCGCAACCTTCCCTTCAATCACTTAACCAGATTTCGACAGTATATCGATCATTTACTGATACATACACCGCTCGCAACGGCTTACCGGAATACTCA
GCTGTTACCGGTGACACGACCCGTGATGTCGTACCAAATCATGGTGATCTGCGTTTGCGTATCACCTATGAGTATTATGACGCATCTGTTGTTGGGCGTC
GTGGTAGAGAGAATACATATCACACGGTGAGCCGCGACTTTTGTTGGCGCGCCAGTATCAGTTCGTGCGTTCGAGCCTGCAAGTTCTGTCAATGGGTGAA
GTCTAGTCCTACCCTTCGTGCCCCGTCGCAGCCTCTGCTCACCCCGGCAGAGTGCTGGGAATTCGTTTCCATGGACTTCGTCTTCAGATTCCCTGTAGAT
CCACACAAGATTACTGGCATTCTTGTGTTCATTAACATATTCAGCAAGATGGTACATCTAATTTGATGTACCCGAATCCATCAACGCATCGTCTTGCGCT
CGTGTCCTTATCGACACGATATTCCGCCTTCATGGGCTGCCTCGTGAACTCGTGTCCAACCGAGACCCGCGGTTCACAGCTGAGTTCTGGCTTTCCGTGC
TCAGAACACTCGGAAAGCGTTTATGTCTACATCTGAACACCCTGAAACAGATGGTCAGACGGAACGCGCCAACCGTGTTCTTAAAGAGATCCTTCGAGGG
TACGTCTATTCGTTTACGAATTGGAGCGAATTCTTACCAATGGTGGAATTCGACATCAACAACTCGGTACTCGCTTCGACGAAGCATACGCCATTCTTCG
TGAATGGCTTACGCCATCCTCTTCAACCCACATTATTAGAGTGTGACTCTAGTTAAAGGGAGGGGA