Description :
From Genome Similarity Track
Location :
Scaffold_2:171426- 172443
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001121Similar to At3g04970: Probable S-acyltransferase At3g04970 (Arabidopsis thaliana)

Sequence
1017 bases(100 bases per row)
AGCTCGAAAGCAAAGTGGAGAAACCAAAGACCAATTCGCGCGAGTGGAAATGGCAGCCGCGCTTCAGCACATTGTCTCGGTACGCTCCACTCAACTGCTT
ACAATTGGAAGCTTCCCTAATAATTTCATTGTGTGGCTACAGCGCAACCAATCGCTCGGGTTTGTTGCCGCGGTCTCGCTCATGATCGGCCTCGTCGTGT
GGCTGTTCATCTTGATGCAACTGCGTCGCATCGCGCTCAACACGACGGCGAACGAGTCGTTCAAGCGCGACGATCTCTACGAAGCTGCCGAGCTGGATGG
CGAGACCACAGGAAGGAAGATGTTCAGCGTGCTCATGCAGCAACTGCGTCGCAAAGTGCGCAAGGGCAATGCCAACAGCAGCATGCCGCGCAGCGCGCGC
AAGAAGGATCTCGACTCGTCCTGGGGCGGGCTCTTCTCGGCGGACCTGATCCTCAACACGGAGGAGTCGTTTTCCGTGAGCGACGTCAAGTACAATCCGT
ACGATTTGGGCGGCTTCTGGAACAACCTCAAGGACGCGCTGCAGGTGAAACCTCGCAAGCAGCTCACGAAGGACGAGAAGAAGCAACAATGATTCATGTT
CTTGTTATCTAAAAAGGCACGCAGTTCGATAGGAGCTATGCCTAAGGAATCGAGTCCAAGAGATGGGAGACGAATGGAGAATATATACGTGGGTGCGAGC
AGTAGTTAGTAGTATAGGACAGAGGGACGTAGCACACAAATCAAACCCAATTCTGGCTATCTATCGAACTGCGCTCGCTTCAGAGTGAGACCTCGCTGTC
GCCGACGCGCAGCTTGTTGTGCGACGCACCGTCGCTGCCGAGAGACGACGACGAGCTACTTAGCGCCTTGTTCATGCTGTTGATCGCCTGGACCGAGTGC
ACGGCAGCCTTGAATTTCTTGCGCGCGTGGAAGCGGCGCAACTCGGTCAACGCGCTCGTGAGCGGCACGGTCGCGACATCCTTGTCCACAATCCATCGAT
GCTCGAGCAAATCCTGC