Description :
From Genome Similarity Track
Location :
Scaffold_1:1714141- 1716194
Transcript NameFunction/comments
Physo_257355type III secretion apparatus protein, YscD/HrpQ family

Sequence
2053 bases(100 bases per row)
GACCTGATCACCGGACCTAACATCACCGCGCTGATGGCCGATCGCCCTTGGCAGGCGCTGCAGAACTCGGCCGATCCGTTGACGTTCGATCTGGCACTCC
ATCGAGGCGCCGGAACCCGATTGGGTCGGATCGCCACTGCCTATCTTCAGTTCGATGAGCAGAATCGCCAGGCCTTCTGGGAAACAACTTATTATCTCCC
GATCACGGCCGCCCAGCGTCGGGATCAGATCGTCGAGCGATACCATCGCGATCGTCGTGCCCGACGGATCCGCCTCGATGATCGGTGGCGCCGACTCCTC
GTCGATATGCTGCCGATGATGCGAGAGATGTGGGCGGACGTCGATCTGTTGCTGGACCCATTCTTCCTGCAGATCCCGGTGCGACAGCGGGACGCTGTGA
CCTGGTATCCTGGCGTGGTATCTCGCGCTGCGAACGTCGTCAACCCCACCCAACACCAAGGCGAACCGACTGACCTCCGTACGGCGCTGATCGAGGCCGA
CACCCATGATCCCTGGCGGAACCAGTACCGCGCCCACCCCCAGGACCATCCAGCCCAGCGGATCCCGCGTCTCCGCAACAAGTTCAACCCCAACGTCGGC
GCCCAACACCAGCCGTGACATGATTGCCGTCTCCACGATCGACTTCCGCGAATACCGAGCCAGTCGACCATCACACCCCAAGAATAGGAGTGACGCGGAG
GCCGATCTTCCATACACGTAGCGCGAAGTACTCAGATTGATCCATTCCATCGTAATAACCCACATTCTTCCTTGATCTTCCACTGTTCCCCGTCAATCCA
TTCGTTGTTAATTCGATCGGCCAAGATCTGTCCTCATGTCTTCCTGTACTCACTCCATAACCGTCCGATCTGCACTCACGTACACTCATTCGTTCATATA
CAACCCCTTCCTCCGATCAACGGCCTCCCCGTCGATCCGTCATCCCTCTCTCTCACCAAGCTGACCCGATCTCACTCCTCCTCGCGAGACTGCATCGCGC
TGAATCGGTTCCGGTTCACGCGATCTCGAAGGAACTCGTGCAATAAAGCTCCACAGTTGAGATCAGCTTCGTCGACCCAGTCAGGCTCGTCGTCACCCTT
CCAGTGCACCAGAAATTCTCGATAAGTCCGGTCGTACCGCGTCCTTCGACCCGTCCGCATATCCGTGATCTCCTCTACTTCGTACTCATTCGCGTCTCGA
TCTGGGGCCCAGCTGTCCTCCGGAAGTAAGACTTCGTCGAAATCGAGTCGATCCGCTGCGTCCACCGTGAGCGCGATCTGCGGTCGATCGGGGAAGTCCC
TGACCAGCTTCAGCTTCGAAACATGCACGATCGGGAACAGGTGATAGTCCGTACCAGCGATCTGAAGCTTCATCGTATATTCGTTCATCTTCTCCGCAAC
ACGGAACGGGCCGTGCCACAGGTGGGCCAACTTCCGGGCATACCCCTCTTTCACTCGATCTAGGTACAGCCACACCTAAGATCCAGCTTCGATCGAGTGC
GGTCGAACTTCTTCATTGTGTCGATCGGCCCGATCCGCGATCGCCTCGCGTAGTCGAGCATTCACCTGACTTGAGCCTGATCGTAGTGCTTCTGGATCCG
ATAACGCCACTGTCGAGGATCCCGATCCCGAGTCCGGGTACTACCCAAAGGTATCGTTGCCTCGAGCGTCGATCGAGGATCCCATCCATGCATCAGATAA
AATGGGGAGTCCCCACGGACCCGATCCTGAGCCGTGTTGATCGCGAAGGTCAATCGCTCTGCGTACTCATCCCAATCCCTCTAATCCAGATCCTCCACGA
ACATCTTCAGGGCCCTCGTCGCCGTCTGTACCATTCGCTCTGCAGTTGCCATCGTCGCTCGCTGGCGGATACCCAGGATCTTGTTAAAGGCGCGGAAGAA
GTCAGCCATAAATCCCGGCTCTCGATCGTGCCTGATCACCTCGCTAGCACCAAATCGCCGGAACACACACTCTTCGTAAGATTCGGCGATCGTCTACGCC
GTTCGGGAGGAACTGGCCTTCGCGATCACGTATCCCGTGAACAGATCGACCCA