Description :
From Genome Similarity Track
Location :
Scaffold_371:17141- 19713
Sequence
2572 bases(100 bases per row)
CGTTCTGATAGTACGGCCGGAGCCGCCCCACCTAGAACGTAAGATTCGAGTGCATTCTACGAGGCAACTCAATCGCGTACGCATTGCCAGTGGGATGCGG
TACAAGAAAGGGGTCTATGTACTTGGGTAGTAGATTACTGCTACCCACGTTAGTTACTACAAGTTTAGGTAAATTTTCCGTAGATTTACCGTGGACAGTA
GAACGAAGTCTCGAACATTAAATAGAAGAACGTTTTCTTCCATATTGATCAGCGTTCCTTTTCTGCCGGTCCACCGCGTAAGCGATGGAGTCCTGTACGA
AATAGACCATTGCTTCTCGTGCCAGCACAAATTTCACTGCCCACTCGCCTTTGTTTGTTTCAGTGCGCCTAGCGCGCACAGCTAAGCGATCATTCTCTTC
TTCAACGAGGATTTCATCATCCTCGCCGGTGTGGTCATTGGCGATGCTAAATATACTAGCATCGTCATCTTCATCAGAGTCAGCAATGGTGTCGCCAGTA
TTGCTGAAGTTATTGCCTTCGATGTCGATTAATTCGACATCGGCATCGTTAGCGTCGTCGATTACCTCGACGCGTGATGATCAAGAAACAGAACGGTTTT
TGCTCGAGCGAATCCCCCCTTGAATCAGTGTCACACTCTAATTGGGCGGGTATGCGTGGATGGCGTAAGCCGTTCACGAAGAACAGTGTATGCGTTGTTG
ACGCATGCACTAAATTTTTGAGTGCAAATTATACCATTTCGTCGAAGTATCTCTTCAAGGACGCGGTTGACGCGTTCCTTCTGACCATATATCCCTGGAG
GATAAGATGTTGACATAGTCAGACCTGTCTTGAGTGTACCTGAAACGGATAGCTGAAACTCGCCCGCCGTGATCCATGAGTCTCTGTCAGAGACTAGTTC
ACGGGTAGACCGTGGAGTCGAAATACCGTGTCAATGAAGATACGGGCACAGCCCTGTGCTGTGATCGACTCTTAAACTGCATCAAGATTTACCATCTTGC
TGAAACGGTCAACTAACACAAGAATACCATTATTCTTGTGTGCGGCTTTGGGAAACCCGAATACGAAGTCCATTGAAATGGACTGCCAGTACGCTGCTAG
ATTGGGAGAGGATGTAGTGGTGCACGGGATGAAGGATTAGGTTTCACCCGTTAACACACCTCGAAAGCACGAATATACTTGTGTACGATGTGGTACTGGC
AGGGCCAGTAACAGTCGCGACTAACGGTGAGGTGAGTCTTTTCCCCACCAATATGCTCACCTGATGGCGCATCGTGAGACTCATAAATGATGTGCAATCG
CATATCGTTATGAGTGAGAAAGACGAAGCGAGGAGTATCGCCGGCAACGGCTGTGTAATACGGCAACCCGTTGCGTATTGGGTATCGATCTGCGGATGCT
CAATACAGGGCAGGTAAATCTTTGAGCGATTTACGAGATGGACACCAGATGATCCACCAGTCGCAGAAGAGCCTTAGCTTCTACGTAGGCCTTCTTTATG
TCTTCAGCCGGTGTTGACGACAAAACACTAGCGATTAGTATTACAACAGTGGGATTAACCCCACTGTTGGTTTGCGCAGCCGACTCGAAATTCGGTCGGC
GTGACAACGCATCAGCGACGACATTGAGTCGTCCTGGCTTATATTGCTATACTACGCGAAGAAGGACAGCCATCTCGACATACTTTAAGAGTGGTGTTGA
CTGTTTACGGCCGTGCGTAATAACGTAAGGTCCGTATAGACTACACACGGTCTACCTCCTAGGGGATAGTCGCGAAATATAGCCAGTGCATATTCCATGG
CAAGAAATTCCTTGTCACGCAGTGAGTAATTGCACTTGGCTGCTTGCAGCTGACGCTACTGATAGCAGACGGAACATTACGCACCTTCTGCACCGTACTA
CAATAATGCGCAACCGCTTGCGAAGTCACTGGCGTCACAGACTTGTGGAATGGTCTGTCTTGATCTGCAATCTCCAAAACTGGTGATCGTATCAAGATCC
GCTCGATACCTTCGAAGGAGCGCTGAATCAGCAGTCTATACCCATTTCTCTTTTTTTCTAATTCAATTAACGAGAGAGATGAACAGTCACCTCGGCGTAA
TTGTGCGAGTATTTGATGCAAATACGTCGCTAGGCCAAGGAACTTTCGAAGTCCCTTGACATATGTAGGCACCGGCCAGTCGGTGATCGCTGTGATCTTT
TCGGGATCGGTTCGGACGCCATGCTTGCCCATGATGCACCCAAGAAGTGGTATTTCGCTAGCAGCAAATACACACCTTTTGAGGTTTGCGTATAACTTAT
GATTACGCATTAGCGTAAGAACTTTCCGGACGTGGAGTCGGTGCACTTCCACATTCGTCTTTCCATCCATAGCCCGGCTATGGACGAACACATCATCGAA
GTAGCTGGGCGCGAGCTCTCTTACGGATCTTAATAGATTCATTACACATCTATTGAATGTGGCAGGTACATTACTTAGCCCTTGTAGCATTACTAACCAC
TCCCAATGAATACCACTTTAGGTGCTCACTGCAGTACAGGGAATGTCTCTTTCCGGCATAAGGATCTGATAG