Description :
From Genome Similarity Track
Location :
contig_54:171370- 194566
Transcript NameFunction/comments
g10786.t1hypothetical protein

Sequence
23196 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGC
GACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCATAAAGTAGCCCGCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGC
TCATCATACCCAATCCACTTCACCTTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATAT
TCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGAAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTTCG
GTCGGTCTCCAAATTCGTTGACGGCCTTGAGTCGGGACACGTGCACCCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCAAACT
CTTCGATCTTTTTCTTGATCCTGAATGGTCCATGCCATCGGTGGGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTCTGCT
TCCGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGATCAGATGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCATCGACATTC
GGTACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGAGA
TTTCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGATTG
TGCGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCCAG
TCTTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAGGG
TCGCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTCCGAA
TCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGAAC
AGTAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCTGGCG
AATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAATAGTC
TGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGCACC
ACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACGAACTTGTCGG
CCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCTGGGC
GGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTCGGAGCGCCAGGGTCCGCCTCGTTGCTCGATTGCTCGGCT
CTCAGCTCGCTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGCACCATTCGGCCCTATCACCGACGTTTCATCTGCAAACTGGACTC
GTTTCTGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCCACGGGCTA
CTTGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTCGACCAATTC
TAATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGGACCACGTGC
AAGTACTTCACCGACCGCAGCTTGGTCGTGAGCTCTCGGTGACGATTCAGTTGTACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCT
GGATTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACTCAGCGAGGTT
TACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCATATCCACCGTTCTTT
TCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGTAGGTGACC
CTTTCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAATCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTACAATCGCGTTCCTTG
ACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTCGAGCGTCGAAA
AACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCGGGTGGTAGTT
CATCTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAACTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCG
AATAACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCCGAAGCTTCGTTTGGCCGCCGAG
AGGCTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATAATTCAGCGCAC
CGAGGAAAGACTGCATCCCTTTTTTCGAAGCAGGGAATGGTAGCTCGGTCACTGCTTTCATTTTCTTGGTGTCGGCTCGAATACCTTCTGCAGAGACTTC
GTGTGATAGGAAATCCACCTTCGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGTAGTCGGTCTAGCACG
CGTCGAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCATCCGGTTCTCCGGTGGAGAACAT
GTCGGTAATAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCTTCGAATTTGGTCGGCGGAGTTGCGGATTCCTCG
GGTGACCGCGATGAAGGGTCGGTCACCCCTGTCCGTGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGCTCCGAGAAGTGGAGCCAGCCGCCTTTGG
GTTGGACGAAACCCCACAGAGCATTGTCGATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAAACGGCATACGAAGCCATTCGAAATGTCCGAG
TGCACAGACGAATGCCGAGACCTTGCGGGCTCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGCGAGCAGAACCATAAAGTAGGCTTC
CAGATCGGTCAACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTGTAGTCGATGCACAACCGAATATCAACT
CCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGACGAGCTTTCAGCAAGCCTTTCAGAAGCTCGTACAGCT
TCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACACCACACCGTAGGCCGGTGGTGGCAG
AGCATTCCCACTCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGGCTGTCGCGCTCGGGTTCAGAACATTCGGT
CCTGAATAATCCAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACTCGATCTCATTCGCTAAATGTT
CGGACGTATTGGTATCGGTGTTCCCACTACCTGAACCGTCCCCCGCGGTAATCTCATGCATCATTGCTACGAAGGCAGAGTCCAATCGGGTCTCCGGGTC
ATCACCGAGGACTGGGATGGAGTCTCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCGCCACCGAGTCGTCATCTTCGTCGACCCATC
TATCTCCAACGGGTTCGTCAGAGGGTTGCACCGAAGTCGTCAACGGCATTCGGTCTCGTTCTGTCGGTTCCTCAGTGTTCCTATTCGCGAACGTTATCTG
GCCCTCGTCTAGGCCTCCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCGTTCTACAGCTGGTGGCTGATCTGCCAAC
CATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCCTCATACTTAGCGGAGTTCAAAC
GAGTGTATCCATCTCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAATCTTCGGTGACACGTTCGTTAG
TCGCACCATCGTCGGCTGCCCCCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACGTCGTGAGTAGTCAGAGGCGGCCGT
CGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTG
GGTTCTGCGACTTCACCAGGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCCGGCTGGAATCATGAAGTCTGT
TCCCAGGACCACATCAACTCCTGCACTGTGATCCATAACCCATACTTCAAATTCGTACACGCGCTCCCAGCCTAGCGTGACTTTAACGAGTGCTCGTCTG
CGGGTCTCCATCACCCCTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGATCTGGAACTTCGCGCAAGCGCAACCGTTTCGCGTATGACGCGGAAA
TCACACTGACATTCGCTCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAATCGCTTCCTCTTGTCATAGCG
CTGGGATGACCACCACCCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATTTTGGCCATGCTGAGGATCGAA
GCATCGGTTAGCTCCACTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCTTTACATTTTCCGTCGTTTTCA
CATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTGGCTAACTGTGGCAGCCCGAT
TGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGAGGTCCTTCTTCTCGACCTTAG
CTCGGAGGAGATTCGTGAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTTAAAGCAGTAGTGAGCCGAATG
GGTGAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCTCGGTCATACGGGCGTTGGCCG
TTACTTGCCCTCGGCGACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCAGCAGCCACGTGGCCTCGGTCCTC
GGTCGACGCGTATCCGTCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACTCCTCGGTGTCATCATATCCGTCG
TTGTACGCTTCCGGGTATCCTCCACGCGCGTCCACCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGCGTCAGTGAGAGTGACCCTCGGTC
GATATTGTTGGTCATCCCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTCGGTCTCGGCGATAGCCGTCCCG
CGGATCCTCGGAGCGTCCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCCAGATTTTCGCTCTCTGCGACGA
AGGATATCATTGATCATATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGGTCTTCGCACGAATCCAAGAAGT
GCTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGGTTGAGGTAGTCGCAGACATGCTC
CTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTAATGAACGCATCGCTCAACAATTTCCACGTG
CGTTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCATTCGTTGGGCGGCGTGTGCGTCCC
TTTCATCTCGTATATGAACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTGATGTTTCCGAGTGGGAGGTGCGTG
GCGATCTCTAGCCTCGGTGTCGCACTGTCATTCTCCACAGCGCTCAACTCACGAATTTGGCGTGCCCATTCTCCCGTCAAGTCACCCCCGGTGTCTCCGA
CGTCGAACGAATCTTCGTCAGATGAGTCGTCGCGGAGGTCGTAACGTCGGCTGGGCGTCCGACTTGCGCTTCGTCCAGCAGTCGGAGCGGTTCGATATCC
CTCGGCCTCTCTCGCCAGTCGTTCTGTACGACTGACCGACCTTGGCGTCACCATGTGAGAGTCTTGGAAATACGTCGACGTCGCACCTTGGGCCGAAAAT
ATTCCGGCCTCGGTCGACCCTCTGGGGCGTCTCCCAGGGGTCGAAGGCAATGGAATCATGGACGGGTCGACCGGATCCGATGCGTGGCGGACGTTCGGTG
GACGGCTAACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCGTCCTCGGGTGCCCATGCTCGGAG
GTCTGCTTCCGACGGGAACACGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCCGAGTATTCCACGACTCCACGGGCACAGTTAACTCGCCACCGAGC
TCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTGCTCTTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGTTAAG
AGGAGGGCGGCCGCCATTCGGCCGAGAATTCGCATCCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAACCGTTGGCTGGTTCG
GGACCAGCCACTTCGTTCAACTCTTCGGTGAGGTTTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGGCTTCCGAAAGCTCGG
GCATAGCTGCCTTCTCTTCCAGGTCATCTTCTTCGTCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGA
CGCCAACGTACTCGGCGTCGCGAACGACGAACCGGAACGCCCCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTC
GCTTCTTTCGCCATCTTCTTTCTTCTTCTCTTCTTTCTTCTCTCGAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCACACC
AATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGAACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAA
GGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACC
TTAAAACCTGCACTACTAGTCCCGAGCGAGGGCTAGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACGCCTAATAC
GGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTGTCGCCCCTAACTC
TCGGCCACTCCTATCTCTTGGACTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGAC
CCTAAGACAAGCTAGCTAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGATGATTTATTTCTCTTATCCTACAGCTCTGGGAG
CCTCTGTAGGTCATCATTTGGCTAGTCCTATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGA
GGGTACGACACGAAATGGGTACAAACGAGGCTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATAGCGCGGGAAATGAGAC
CCGCCAATCAAGACGCTCTGTCGCCGTTCACTGAAAGGTGCAACGTCAGCCAAACCGTGACAGTTCGGCACCAAAACCCAACGCCACAGTCGCAAATGTC
GTGGTGGTATCCCAGTTTCAGTACGTTTGCCCCTCACTGTACCATTTGTACCTGGCGGCATGATAGCCTTAGTGTGCTCTCGTGACCTTATCGAGGTTAT
TTCCAACAATCGAGTCTGAGTGGGGAAATGCGTAGATTATCCGTAGCAGGTAAGAAGTACAGTGGTCACGGTAATGAATCTCATTGAATTTATTTTGTGT
TGGGAAATATTTTTACCTACCACGCAAATTGATCAAAGTGGATATATATATATATATGAATGCAGGTTAAATTGTGTAAATTAATCTCACTGTTTCTGTT
TAAGGTTACACCAAAATTATATTCAGTCTGGATAAGCTATGTCATATATCCGAGTACAGCCCTCCGCCAGGCAATGTTCCGATAGTGGCGCCACTTACCG
CCTCGTAGTCTCCTTCCTCAGCTTTCTCGGTGGTTGATGGCACCTCGTTGGCAAAGTGGTCCGGGTACTTGTGAGTTGTGTCCCGGAGATGCGGAAATAA
CTGCTCGACATTCCAGGTTCCGTCAATATCTAGAGACAGACCGCATCGGATCATTGCCTTCCGAGCGTAGTTGAGACCTTTCTTGTCTCGCTTCGAGTTA
ACATTTCGTACGGCTTCTGCTGCGAGCTCCAAGAAAAAATTATTGCCGGGAGTTTTCAGCTTGCCTGACCAGGCACCACCCTTCCAAACTTTGTCCTGCC
ATTGCTCTTCCTCAATAAGATCAATCTTCTTTTCATTCCATTTGCGAGCCCACACGTCTTTGATCTTTGCGATGACGAACGAGTCTGCTGGTGGTTGACA
CAAATCCGTGGCGTTTGCTGGGAAATACCTAAGTCGGGCATTAAGTTTTTCCAGCTCGGTCCTGCAGTCATCTTCACTCAAATGGGAGAAGCAGTTGTCC
AGAAAAATTGTTTTTCGCGCCTTAACTGGTCTCCACTCATTGATCTCCGTTCTCCAAGAAATTCATGGGAAATAAGCTTGTCCATCGAGCCTTTTGGTCC
TTTTCGATAGCATACCCCTGGAGTATCGCCCTTCACGCCTCTAATTTGATAGCTTGAGTCTTTGTTCATGAATATCATCGTCGGCGGAAGAATTCTCTCT
CCAGGCCCTCCAGATATCCTTACCACCATTGTCATTCCTTCTCCTCCCGAGACGACGTCAGCATAGTAAGCCCAATAGTGAAGCTCATATTAACTTTTGT
CGTGAGATTCGTTTCAATCTCAGGATTTCTTTCGCACATAAATTAATCTATATGACATCCAATGAGATTATAAAGCGTGTGAGATTATTTTCCAATAGAG
ATTAATTACGGTGACCACTGTAGCGGATTAGCGCTACAAATGAAAGGTTGGAATGGCTAGCTATCAGTGTTCTTTCGCGCGATCGTGAAACCTCTGTTTC
TCTCGTGACTTGTGACTTTTCGAGAACTACGTACGTTGCGAAACTACCCAATGTCCGCCGGCAATACCTCCTCGACTGTTCAATGAGGTGAGCGAGAAAA
TCAACTTTGACCTATATAAAGACCACCAAGGATCACCCGCTTGTAATAGAAACCCCTAAAACTGCTCTCGTTTAACCTGAAGCACATACCGATATTGGCG
ATGGCTTTCTGAGAATTCACGGCGAATCATACGTAGTCGATGTTGGAGAGATCCGCCAACCGAACCGCCCTTAGGGAAGCGCTAGCGTACGCTCAAGATA
CCCCGGTCGATCTCATAGCGAGCACCTGCTAGTGGATGCTAACAACCGTGACGGAAACTTGAGCGATGAAGAACGTGAGCCTGCACCTGCGGTATTTGGC
CAATCAGCTACCGTGCGTCAGTCGAACCATGCTCAACGCGACATTCAAGGAAAGTCATGCCCATATATACTCGAACAATGCACAAATCTGCCAAGACGCA
GCTCCTCTCGTCTGTCGCGAACTTCTCAATGTTGAATTTGACGCTCACGGTCTTCTGTTCATGTGCTCCCGGCCCACCGATTTCTGAAAACGGGTGTATG
CGAAAGACTGGGTTACGTGACAGCTAGAGGTTGGCCAGAGGCGACGGATGACCAGGCCACTCTGCAAGATCGCGACAGGCCCTATTATTGCACGCGCTTC
TCAAGTTGACACTTGAATTTGGGTTAGACAATTGGTCCAAAATGAGACCTTTTTATTACGAAAATGACATGCTCCCATTTTAAAGGACCTATCGCACAAA
GCAGCACTAAATATAAATGACTCTGTATGAAAGCGATTTCGGTATAGGGTGTACAGGTGCGGACGTGGTGGGTGCTTTTATTATCGCTGTGGTAGTGTGG
CCTCTCAGAAATTGCCTTCTGGGGGGCTTGGTCAACACACAAAGCGTGCTTCGCCCAAAGTGAGGTTGTGTGCGGTGTACAGAATTCCTGGGGTCTTGAC
TAGTGTGATTGCTTGGGATGGTGGCCTACATTTCTGAATCAAGTGTCGTCAGCTTTGGTGACGTCTGCGTGAAAATATTCAGCGACGTCGGGGTCTTGGA
AGACATAGCGTGTCTCAATTGCTGTTACTTCTTCTCCGTAGTGATATGCTTTGTCTTGACTGTTGCATTGGTCGATGAGTTGCTATTCCTGCCCTTGCAG
AACTTTGTTGTTATACCTGACCTCGCGGGATTTGAGTTTTATTTGACTTCTTGTCAGACACGGATTGTGTGTGTATGAGGTGGTGATGGAGGTAGACAGA
GAGAGAGAGAGAGACAGAGAGAACACACAGCAAGTGTTTCTCGATCAACTGAAGCGCGCGTTGTACTTCCCAGAAATAGACGAGGGAAAGACTTCGTGCC
CAAGAAACGTGTATTGCTTTGCCTGAGCTCTTGTCTGCTGCCCATACGATTTTTCAATGACTTGCGCCGATCTCAAACTACGTTCGGTTTACCTCCATAC
ACTGATTAAGCAAAGGCGTTTCGTGTTCTTAGCACACTGTCCAACGATGCAATCTTATTTACGCCCTCCGAGAAGCGCCCCTTAAAGTTCAACCTTGAGG
TTGAAACATCAAGCGTCGAGCATTGAGCACCGACAATTGATTATCGAACCTAGACTGAACCGAACCATACCGTTCCGTATAAATGCAATTTCACTTGCGT
TCAACCCGTCGTGTATTTCGAATGTTTCTCTAAGGGACCCAATTCTCGACGTGGCGCCTGCCGACTTCCTGTAAATCTCCGGGAGTCTACTGCTCCCCTG
GCCCACCTAAAGTACCACAACCCAAAGTTCGCCTCGGTTCGTCTTCCTTGCTTTTATTGCTGTTATATATCAATATTAACATTTCATTGGTCGAATCATA
CTATATGTCAGATGGTAGGCAACACGTCATCTGGTAGACCGGCCAAGCATGGGTAATCTTTGCATCCCTTGGTGCGTGAGCTGGATTCCGAAATAAACAA
GAGCAGGAAATTTGTTGCTGCGCCGTAATTAGCCAAACGGTTAAAAGAAGTGCACGACATCTCGATTTCTGTGTGTTCTCTCCATCATATGCTTCGACGT
ATGGGCATACGATTTATAAAGGGGAAATCGCGCAATATTTTGGCAGAATCTACTGCAAATGTTGTATGTTCGACGCAATATCTGGGAACAAAACTGGCCA
ACCGTAACAGAAGAAAATTTCCTGAACGACCGGAAGTGTATTTGGATGAAACATTTTGCAGCTTGCACCACGTTGCTAAACTGTCTGGGGTCGATCAGAA
TAAAAACCGGTTTACAAAGAGCGGTAACGGTCCGAAGAAAGATTATATTATTTATGTGTTACTTCCTCCGAACGAAAATGATTGGGATAATTGGCCAAAA
CGTTGCATAATTCCATCAATGTTGAACATTTTCGCCTGCTGATTGGATGAGTTCCTCGGAAGCGATTAGAGCTGCATTAGCATACCTTTTTCGGGTTCGT
TTGCGCAAAATTGACTGAGCAATGAAAGTTGGCGTGGGCTGCCTGGGAACCATCAGTTTAGAATCACCCGCTGACGGTGCGCATCACACTTCTGCGACTG
AAAACAGTGCACATGGGGAACCTTTCCGATTCTACAAGGCGCGCAATCGTAAACGACATCCTGCGGAACTCTACGGATGGCAAGGTGCCTCATGGCACGT
ACGCAGACTTGGCAAAGGAATATGGCTGCCACTGGCACACGATCGACCGCGTATGGAAGCGCTACACGCGCTAGGTGTCGTGGGAGGTGCTCCCGAGAGC
AAGATCAAAGGAAACTCGGGGGCGCAAGCCGTACGATCGCGCCGAGCTGGCGAGAAGATTTTCGGCAATTCCAGTGACGGAGCGGCGGCGGGTAGCATCG
ACGGCGGCTCGTATCGGCGTCTCTGGGTTCCTGGTGCGAACGCTGCTTGCGGAGGGGCATCTTGCGCGTCGGTCAGGGCGCATCAAGCCGCTGCTGAACG
ATAAGCAGAAGAGAGAGCGCGTGCGTCATGCGCTCTCGTTCATTGACGAGCGCACCTGTCAATTCGAGGGAATGTACGATGTAGTGCATATCGATGAGAA
GTGGCTCAACGAGGACGTTGACGGTCGCACATACCTGCTTCTTCCCGACGAGGAAGCACCGCAGCGACATCGTCGAAGCAAGCGCTTCATTCCTAAGACT
ATGTTTCTCGCAGCGATTGCACGGCCAAGGTAACCTCTACAATTTTATGTGATGTAACCTACGCAATCTAACGTACCGATATCTCTTCTAGATACGACTA
CAATCGCAAGACCATCTTCGATGGCAAACTCGGTATCTGGCCACTAACAGAGGAGTACGTCGCACAGCGAGCAAGTATCAACCGGCCCCGGGGAACCGTT
CTCACCCGAAATATCGCCTCTGTCGATCGCGAGGTTATCAAGCGGTTTCTGCTGGAGGCAGTGTTTCCAGCGATCAAGTCAAAATGGCCAGCGCGCGACC
GTAAAAAGCCGATCCTCATCCAGCAAGACAACGCCAAGCCGCACGTGTTTGCTGATGATCCAGACATCGTTGCGGCGGGGACAGCCGATGGGGGAATATC
CACCTGTTTCTCTCAGCCTGCGAACTCACCTGACTTGAATGTTCTTGACTTGGGATTTTCGCTTCAATCCAGGCGATCCAGATCGAGAAACCCATCTACG
GCATCAACGCACTGATAGCTGTAGTCATTGATGCCTACGACCAGCTACACTACACCACGGTGGATGACATTTTTCTCACTCTTCAGAATGTCATGATATG
TATCCTACGAGCTGAGGGTGGCAACGAGTACACGCTGCCACACATGGGGAAGCAGAGGCTTCGCCGCTTGGGTGAGCTGCCAGAAGTGCTGACATGTCCC
GAAGACGTCTTCGATAAAGCTTGCGGCTTTACAGGTGGCGATCCCTTTATCGAAGTGAGAACCTGTAGTAGTTAATACAGACCATGCTCAAATGTCCCAA
TCATTTCTACCACCTACAAAAATTAATTATCCCAATCATTTTCGTTCGGAGGAAGTATTCATTATTTATGCTAAACTTTGCTATAAAAGAATTTGAATCG
TAGCCGCCGGTATAATTCGCCGTGAAAAAAACTGGAATTGTGCGGAAGCTGGTCAAGGGATCGCGTGAGGTCAGCCAATCCAACCGAAAGCGTAAGCACG
ATGACGATTACCACGGGAATTTTAACATTGAACAATTTGAAAAGTGGTTCACAAATCTGAGTGCTGTGTTGGCGTGCAAGTATGGTTTTTATAGTATTTA
CATGGACGGTGCCAGTTATCACAAGAACCAGACGAATGCTGCCCCGAATTTAAATTTGTAAGCTCAAATTTACATCTAGAGATTTGGTATGACACAAACT
ACACCAAAACTGAGTTGATGATGTTCGTCCGTGCAAACAAGCCCTCAACGATCTATAGAACGACGGAAATCTCCACTTCTTATGGACATTTAGTGTACTA
TGCGACCTTACCACCCTGAGCTACCCGCTGTCGAGCTAATTTGGGTCCATATTAAGGGCAGATTGCTGATGACCTTGCATCTAATGTGGCCGAGCTGCGG
TAAATAATCCTATGGAACTGTGTATCTTCAGCTGTTATCGCGTTATAGAACATTACATCACTAAACAACGAATGCGTGTCGGGTTGCAATTGAAAACTAC
AAAGCAAGAAAAAAAAACTTGCGTCGGCAGCTGGCATATAGGGGAACAACTCAAAACGCGCAAAAACGCGCAGCAAATTTGGAATCGACGCCCGTTCTTA
TCCCTTATATCTAATTGCTGGAATACTCCGCTCCCCCCTCCCATGCGCAATATGTGTTACAAGAGTTAGCGGCCAACATTTATTCTCTTGCGGTTGGTAA
CGTTAATGCCGAGAACCGAGCTGTCGGCCTGCTCAACCATGCGCCGGTGTTACACACAGAGCTCGCTGACGCAGAAGCGTAATTTGAGGGTTGCAAGGCC
CAGCCCTGTAAACTCACACGTTCCCCGTGTCCAACACATAAGCGATCGCGCACTCGATCGACGAGAGACATGCTCTCCGACTGGAGCTAGGGAAAATTCA
TCCGTCACTAGAATCCGTCGGAAGCGTGCTGGCTAACGCTCGGTCTTCCAGTGACCTATCCTATGAATCCACGCCGCAGTGACGAATCCACAGTCCAGGT
ACAGGGTTACATGAGCCCTATACCACCTCGATGGTGGTGGCTTTCTGCACACAACCAAACTCAGACACAACCACACCTGCCGCGCTCGCCTTCCAGCGCG
TCGTGCCACATCTACCACAAAGTTGTGTCGTGCCGCTTTCTGCCCTGGACCCATACATTGCTAAGTCGTGCTGTGGCTGCTGTTCGTCTAGCAGCGTCCG
ACGCTGTGTCCTGGAGCTTTCTCGCGTATAAATAGACTCCGTATGAGCTAACGAAATGGATCAATTGCTTGTACAGTTGATTCAGTTCGCCAATACTGAC
GATATCTGTGGTCGTAACCTGTCATTAAGCCACGTGCTGAAAACGTTGAGGTGATCCATGGTCATGTATAGACAGGAAACATTTTCATTGGATTCTGCTA
TCGAAAGTGAAGCTACTGTTTTTGCGTTTTGCGGGATATGCAACGACGTCGCAGCTTACAAGGCATGCAATTCATTGCTTACAACAATTGATCACGTCCT
GAAAGAGAATACGCTATCGAAGAGGGAGAGTGGTATCAACTTCAGTGAAGACTTAGCGGGAGACACTGAAGGAGATGACGTAGCATGTGCTGATCAATGC
GCGTTGCATTTGAGCTCGTACACTACGGTGCAATCTGTTGCTAGAACAGAGGCGTAAGCGTACCCTTTTGAAACGTGGGGTCAACACAACAGCAGAGAAC
CAATGCACGTCGATCACGGTCGAAGCGTGGCGTTTATTCCTCCGTGCATGAAGCGAACTTTTAAAAATTGGGTTTCTGTCGGAATTTCAAGGCTGCACAC
GCTATGCACGGATCAAGAACGGATGTGATTCCGTAATCGAATGCTTGCAGACCCCCCTCACCAATGTGGTTGTGCAGCAACCTGGTGGCGTTGTTTTTGT
TAACAATCTCATTTATCACGCTGTTGTACTGAGCTACACTCCGGAAGCCCAGACATAGGACAAGTGGGGATTAGTTGGGTAGAAATGTGATTATCAAAGC
TGAAGATGCCGGAATCGCTTATCGATACGTCAACGCAGCTGCCACCAGGGTTTCACAAGAATCAAAGACAGCCTGGATGAAAGTCCTTCCAGCGCTTACA
TATAAGGATCATCGTGACTGGAACGACGAACGTTACGGTGAAGAGAAGAAATTGCTTTTAGATAAGCTGCAATTCGACCGAATTTTCAGAACCAGAAGCG
GTAGTTCTCAGAAAAGGACTAAAAGGAAAAGATAAATTACGGAGAAGCTAGCAGCCGCAATAAAAGCTAATAGACATCGAAAAACGTATACGGTGGTACA
TAAAAAATATTGGAATTGATACAGTTTCGTTGAAGTTGAAGTGAGGATATGGTATACATTTACAACCTTCCTGTTATCATGTTGACCCCTACCCTGCTTG
TTTCTTTTTTTTACAGCAAATCTCTTCAATTAACCTACTCCGAATACGCAGCGCATTCTTTTCTATAGCCGACTCTCTAGTCAGTTTCTTGTACGTGTCA
GCGCGGCAGTAATTACCACCTCCGTGAGGTGAGAAGTCACACAGAGTCCAACCGGATGAAAGCCTCGTGAAGCATCTGACAGGCCAACAACTGCTGTTGG
GTAGCCAGACTAGTTCAATTTGTGTTACATCGATATGAAGTACAAAATCCGCAGCGGAACGAAGCATTTTCAGCATTGAATAAACTCTGACGACTAGGGG
CTGTTCATCTGATCGATCTCCAAACATTGATACCCATTTTTGCTCACTTAAAACCAAAGAAAGACGGATCTCCATCATTCAAATAAACATGAAATTTATA
ACCCCCCGCTAGTGTCTCTATGTCCTCAATAAAATCGGTCTCATTCAATTTGGTCCAACTTGTGGTAAGAAAGATATTTTGAACTTGACAGAGCGTGGGG
GTTACGGCACGCTCAGGCTCAAACCGGTCTAAAATATCGTGACGAATACGATTCGGCTTTGTGTTTTGCTCAACAAGCTGTTCTGCAGTCGCTTCTTGCC
CAATGTCAGCTTCGTTTTCTTGGAGACGCCTCGTCTGTTTGATGCGTTCCTGAGCTGAAGATGCCGCTTTTCTTGGTTTCTTGGTACGTCAATACTTTAA
CTTTCCACTTGCATGGTTGACCAGAGTACTCGTTACAACTGGATGCCTTGTAAGCTATAACATGATAACGCATCTGGTAGAAATCCACGCGAGCCGGAAA
TCGATGTCCTGTCCATCAGGGAAAGCTGCCTTCCGCTTGCGGGCATCTGCAACCGATCCCGACTCTTATAGTTAATCGTTGATGTGTTCTTTTTGCCAAC
GTAGACCGCATATCTATAATAGACAGTATCCGCACGCGGCATAGCGTATTCATGATGTGTACTATATAACTTTGAAACTACCTCTTTTGTGATGCGAATC
AGATGTAGTACGCAGTGTGCGCATAGCATGGTACGAGCAGCTTCATCCCATGGCTTAACCTTCTTGTAGCTGCGCGTTTGGTTGAATGGAGACCGCTAGA
AGCATTGATTCTTCACAAGCGAACTCAGCTGGAGGTAGTACCCACGGCGAAATGTCGGCTGCAGCACATGTACTACTTCGGAATTTTCCAGGTCCTGCCG
ATCTTCATACGTAGGTCAAGTTTGCTTGGTAAATGGAGAATTATGCGCCAAGGAGCTGAATGTTGTGATGCTAAAAGTCCCGGCTGGCTGCACATCGATG
TGCCATCCGGCCGACATCGCATGGGTACGCCCGTTTAATCTCCAGTTGCGGGACCACTGGCTCGCGGACATCGAGCAACAATTTCGACAGCATCAACACG
ATGGTGGTAAGTTTGTACTGAGTCCCCCAACACGTGAGGTTGTAGTAGGATGAGTTGGAATGGGTTGTCGAAGAGCACAATCGTAGGTGAATTCAGGAAG
ATTAGCGTGCTGTCTGATCAGGGACAGCCTCCGTTAGATGATGCTGAGGCATACGACAAGAAGCTGTAGAACGTGATCCATCTTTTGTTGAAGTTTAAGG
CTGCAGATGACGACTCAAAGGATGTCCAAAGTGGTAAAAGTAAATAAAAGCACAGTCACCTGCGTTGACAATGAAACATAGGGGATGTAAGTAGATACAC
CTACTTTTGTTGGAACCCTGGCACCAAGATTTCACCGGTGAATGATGTCTTAACTTTCCGAGTAGCCATGAGGAGGTTTCAATCCTTAGTATGTCGCATC
AACGACAGTCGCTTTCACCAACTGAACAAGCGGGATGACCGAATTACTTTTACATTACGTAAATTTCGTGCTAATATACATTACGAACATGGTGACTGTA
ATTTATTCGTATATCTTTTCCCATGGCGCGGGCAGCCTGGTGCTGCAAGGGGTGCCTTTCGATAAGATTTGTACGGTAATGTTACCAATTTAACTCATTC
CAAGAGTGATATTTTAATATTAAAATATTCTAGTAGTTAGTTTGTCAAATAACTATTCAAATATTACTAATAAGACGAAATCCATTACCCAATCCCTGAG
TACAAGCTAATCTGTACAAACCAATTACGCCCCTGGAGGGTAGGGAAAAGTATACGAACGATGGCGTGTTTTTGCTTGGGTGCTGCTGTACATATTTCAT
AGGTATTATAGTTAACATGGGGGCGCTACAGTAGCCGGTGCCAACGGCGGTCACCTAACGCAAGCCGAGATGGCTCGTCGTTCTGAACATGTAAAGGGTG
TGTCGGCGAAGGCAGCGCTCTCTGAGGCAACTCCATTTTAACTTACTGCTTGTTTTTCGATCGCCCTACGAACGGAGCGGAGCCAGCGGGGACTTGACCA
TTTGATACATGGGGCTCTGCGGAAACGCTTTGTCGGCTGATTGAATGCTTGCTCGCTCGATCGCGATCGAAATGGTGTCGTCTTCATTCCTCTCCTTCTC
GAGCAGATCATCCAGCGTCGCACCGTAGCCGAGCGGGTGTTTGCTCGGGTGGTAGATCATGTACACAGTCAGCTGTGCCACGCCGAGAGCCGCGCAGCAG
ACGTTGGTCACGAAGAGGAACCACAACCCAGACATGGGTGTGTATATGATCCACATTGTGTTGTTGAACGTGCCAGCGATCACCATGTGAATCGGAATGA
AGACGCCGGTCTTGTACTTGACGACGTCCTTGATTTTGAGGAACGGCGAGCTGTAGAGCACCAACGTCACGCACACGGCGATGTAGCCCATGATAGAATT
CACGGTGTCCCTACTGATACTCGTGAAAACGCCGAGCCCGCCCAGCACCGCGTACGTAGTGATGATCGAGAGAACGGTTGCGTACACAGCAATGACTCGC
AAGGCTTGCGTTCTGTCGGACGTGTAGCGCAGGAACACGAACATATAGATAAGGGAGATGAAATCCCCCGATACGAAGGTGGAGAAGACCGGGAACCAAT
TGTTGGTCAATAGACCCTGCAGCGTCCAGACGTGGCAGTTGGCAAACACGGACACTAGCGAGACGATACTGGTATTGCCGATGGACTTGGTCTTGTAGAT
CTTGTAGACCGCCGGCGTGGGGCTCAGAATCATCATAAGCGACGTGCTGGCCGCGATCACGCGGAAGACGGACTCCACTGAGCTGGACATGTTGAACTCG
GCGATGGATTGTTTGTAACTGCTCGTACTTGTACTCCACCGGGTGAATCGCAAAATGAGACCAGTCAGAGACGAACTGCACCAAGCCTGCTTTGGGTAGC
ACACTAGCCGCAATCGTGTGGTTGGCTCGTACATGGAGAGAGGAAGGCCGAGATGGGCTGGACAAACGAGTGGTTGAACTCTCGAGCCTTGATGCATCGT
ATGTAGCGTCGCGACTTCGGGTTGGTTGGCGCACCGGAAACCCTGCGCATCTGTTTAACGGCCACGAGAACGTGCGAGACGTCACAGTCTCAGGATTGGA
TGCGCCGATATACTGCCAGACTTCGTCCAAGGCGGTAATGCATGGACGGGCTTGGCATCGAAGTATTTCATTAGTGTGAGAATGCATGGACGGGACCAAC
GCTAGCGCCGCTGCCAGTGGCAGCCTGCCACCCGTTGCGTCCAGCCTGGACTCCAGGCCCTGGATTCGAGGGCTCCAGCTTATTTTTGAATACGACGTCG
CCACCGATTCTGATACCAGTTCTTTTAAGTACAGTGCTACACATAAAAAAAAAATACACGTCGAAATTTGGGCACCACAGAGGCTCGTGTCACGTGGCGG
TTTAAGTTGTTGGAAGCAGGACGAGATGTGAGGTTGATCTTGGTATTTAATTGCTGATAAGTTATTGCGCCTGGTACGACGCATACGACTCAACTGCTCG
GCTCGGTGACAGCCACCAGCGCTACAGCCGTCAAACTGTCCTAATGGTCTGAACTATTCTAGAGCTAAGCCACTTACTGTCGAGGGGCCCGAATAATGTG
CAGGACGCCGCCAGTGCCGACGCGCTCGAACGAGCCACTCGACGGAGGGATGGAGAACTCAGTTGCTGGATAGAACTGCCGCGGCTCAGCGACGGCGAGC
TCAGGTGGAAGGAATTCTCGCGGCTCTGCGCCGACGAACTCAGCTGGAAGGAGCTTTCACGGCTCAACGGCAGCAGTGGTGACGACATGGGCCGGAAACT
TGGGCTTGCGCTAACCACCTTGCCCTGCATTTCGGCCTTGGGCGAGACCACGATCGTGATGGCGACGTCTTCGTCCGGCAGGTTCACAGTTTGTTGAACG
GCCTTGCTCGGTCGGTACATCGCGTACAGCACCAGGAGCACGAGACCAAGCACGACACAGATCGCGTTAGGGATGAACATGAACCAGTTGCTATCCAGAG
GCGTGTAGATGACCCACAACGCGTTGTTGGTCGCGCCACAAATGACCATTGGCAATTGAATTGGGGCTGCATTCTTGTTGCGTAGCACAAACAGAGCCTT
CTCGAAAGGTGCACCGTACAGAATGATGGCGGCCACGATGCTCAAGTAGCCGAGGACGTGGCTGATACCAGTGTAGTCCTGCCCCGTGGCACCTGTTGCC
GCAATGATAGCGTACAGCGTGATGGCACCAAGCACGGCGACGGCCCCGCCGACAATCTGAAGCACGTACTTGCGGTCTTCAGCGAACTTGTAGTATACAG
CAATATAGGTGATCGCGGCGAAGTCGCCGAAGCCGAAGGAGACAACGACGGGGAAGATATTGTTGCAGAAGTAGCCGTACATCATCCACATGTGTGCGTT
GCCGAGCAGCGAGACGAACGGCACGACGGAGATGTTGCCGACGGACTTGTTCTTGTAGATCTTGTAGATGGAGAAGGACGGGCTCAGAGAGACCATGAGC
GACGACAGCGCCGTCATGATCCGGAGTATGAGGAGAACGGTGGCGTCAACCATGATGTTGTGTGTGTGTGGAGATTTACTGGGACTCGACTTCTTGTACG
CACTTGTGCATCCGAGTGGAAACCACTTGCGCGCGGGCAAGCAAATTGCAGAGTGACTGTGGTGCAGGAGTGGGCAAGCCGATTCCCCGGCCGAGATTTT
CGGCGGTCTCGGGACAGGGCGCAGAGGGCTGTCTGTCTGCCGTCTCTCGTCTCGCCCACGATACACGTTTTCGAGTGGGCACAACTGTGCTGCATTCGCT
TCAACTCTGATCCACCAAATCCGGGTCTCCTCCGGTCTCGAGATATTGGGACAACTCGCTGTTACCGGCCCCGGAAATGCAGCTCCGGCGATTGACAACG
GGCTTGTCTCACTTTCTGAAGTTTTGACACGTCGCATGCACGACGATTCGTCCCCAAGCAGCATGAAGGGCGGACGATAGATGAGTCCGTGACAGAGCGC
GAGTCACGCGTTGCTCCACAGCGAGGGCTGCCTGCCAATGACAGCGCAGCACTCGCTCATTTGTCGGGTGCCGCAACGCGGGGGGCTGCCCCTGGCGGTC
GAGCCCAGAGCCGTCCGGTCACAATGCGACGGTTGATGGATACCGAAGTTTCGTTCTCCTCGCTTGGCCTGTCATTAGCGCTAGCGAGCACACGCTGCCT
GGACAGAGGCAGGAAGGAACGCGTGAAGCAGAGCGCCCCGCCACGAGCACCGGCTGCAAAATATTCGCCATTTTCGTTTCTTCGACGAAGCACGCGCCAT
TGATTTTTTTGTTACTCTTGCGGTGCAGAAAGATGCGGCAGACTTGCTTGACGTGAAACCACTCGGCTTTTGCGTGGCAGTCGCGCATCTGTCCGC