Description :
From Genome Similarity Track
Location :
Scaffold_436:17137- 23086
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_436-snap-gene-0.4Titin isoform N2-B

Sequence
5949 bases(100 bases per row)
TGATAGATATCCTCGAAAGGACACCTTGTCGAGCATGAGACTCAAGGTGCTGCTCGTCGGCTTGTTGGCTCGGCAGCTGCAGACTGCAGCCTTCCGGATC
CTGAGCTCGCTCGACGACCCGCTGAACGGCACGCACGCGGTGTTTGCGCCGTACGAGCACGGCCGTGTTGGCTACTATGGCGATCCGACGGTGTTAGAGC
CCGAGCGTGTCAATGAAGGCGGCCCGTTCTCGCCCGACACGCCTCGAGTCTTTTTGTCGCAGCCAGTAGAGCGTACGAGCCGGTCGACAGTTTGGCCCGT
GGGATAGTCTGGTCTGAATGTGTTGTTGCTATTGTAGAGCGCTGTCCCGGTATGATTGGGCCGATCAACGACAACGAGTACTACTGCCACGCGCGCGAGT
ACGGCTACTGCGACCGAAGAAGCGGACTCTGTGTGTGCAACCCGGGCTACACGGGAGTTGACTGCACTCTGTGTCAGCCATCCTATTTCCTCGTTGGCGA
AGTGTGCCTTCCTAAGAGTGAGTTGTGCATCACGACAATCACCCTGCAGCAGCATCTGACGAATACTGTCTACCTCTGATATCAGAGAACTGCCCGAAAG
ATTGCTCGAGGGGAGGCACATGTGACTATGCGACCGGGACATGCACATGCTCGGTGAACCGCAAGGGCGAGGACTGCTCCGAGGTGTTTTGCCAGTTCGA
TCCTCTCTGCGTGAGCTGCACAGCCACCAAGTGCCTGCGCTGCTTTGAAGGATTCTACGTCGATCCTCGCACGCAGCGATGCGGTAAGGTGACTGCGCAT
TCGAGTCATATTTGCGTGAGTCTGATTGCTTCGTTGCTGTGGTGGTGGTCGAGTAATCGACAGTTTCATGCAAACAACATGATCCTCGTTGTCTCTCGTG
CAATGCTACGTCATGTGTTCAGTGCGCCGACTTGGTGCTCAACTCTATTCGACGCAGTGGCGCTCGCACCATCGATGTTCCATTGCCTTTCGACGAACTC
ACACGAGAGTTTTCGCGTCAATTTTCTTTCGGCAGTCAAGATCCGGGAGTGTTTGACGAGGCTGAGGCGTACTTGTTGATCCCGACATCAACTGCAAGCG
GCAGATATCTGAACGAGAGCAGCAAGACTTGCAGCCAAGGTCAGAATTGGGACGCTTCGTGGTCCTGCAAGCCGTTTCCAGTGAGTCACCGTGTGTGCGG
CCACCACGGAGTGTTTACATTTGGGTCTCCGATGTATGCGATCGCCGAGGCGGCACAGAATATTACAATCACGGTGCGGCGGTCAGGTGGTGGCGTCGGG
AACGTCACGATCGAGTATACACTTGAGCACATAACCACTTCTGATGACGATGTGTCTCCGACGGCGTTCTACACGAGCTCCCAGCAGCTTGTATTTACCG
AGGGCGTTGTCGAACTTGCCTTCCAGCTGACCATCCATGACGATTTCGTTGTCGAAGGAAACGAGACCTTTCGGTTATGGCTTCGCCAGCCGACTTCGGA
TACTCGCGCGACACTCGGCAACCAGCGCAGCGCATTGGTGACGATCATCGATGACGACGAGGCACAAACAGTTGCCCTGCGGTCGTATGTTGTGTCTTCC
AACACAACGCTTGCGAAGGGCGGAGTTGCTGGGACCCCGTTGACATTTTTGATCCAGAGCGTGCTTGGAAGCGGCGTGGAAAGAAGATCCGTCAATACCG
ATGTGTATCTGATGGAGTCGTATGTTGCTGACGCTGGTTCCGATGGCGATGTCGATGGGTTCTTGTCTTTGGGCTCCTACCAAAGCAGGCGGCTCGGTAT
GATCTCCAACAACGGGAATGGTACCTTTACGTGCACTTGGAGCCGTAAACTGGCGGGCAGCTACACAGTGGCAGTATATCTGCTGCATGCTGGAGGACTG
CGTGGTGAGTACTACCACGACGCGTGGCTCGGATATCCAACGGCGGAGAAGCTGCCAGCGGTCACTCGTATTGACCGCCACACCAACTTCACATGGGACA
ATGGGTCGGTGTTTTCTGGAGCAGGTGACTATTTGTCGGTGCGTTGGAGCGGCTTTATCAAACCGCGGACTACGGAAGAAGTGATGTTTCATGTGGCCGC
GGACGACTGCTTCAGATTGTGGGTTGACGACTTTCTGCTGCTCGACCGCTGGGATCGCTCGCTGTCTGCTTTCCCAGCCAGCGCGCCAGTGGACATGAAT
AGCACCCGCTACTACTCGCTCGTGCTCGAGTTTCGAGAGCTGACGGGCAATGCCGAGGCGCATTTGTACTGGAGTAGTGCAAGTTTTGCCAAGGAAATCG
TGCCTGCAGCCTATCTGTTCACATCTGAGCATATTCGAGGCAGTCCATTTGCGAACATCCCGATCACCCCCGCTCCAGTGGCAAGCAACCTCTCGACTGC
TACATGGATCCAAGGCGTTCTGACTACTGGTGTCGCGGGCAAAGTGTTTGACTTTCAAATCCTCCCGACAGACGAGTTTGGAAACCGTTGGCATGACCGT
CAAGCAGCCGTGTCGGGTGACGCGTTTACAGCAAGATTGACAATCATCACGGACTGGAGTCTTGGCGGTGGAATTGGAGGATCCTCGGTTGACGCAATCA
TCGTGTGGGATCCGGTGATATCATGCTATCAAGCTGCACTAATGCCGCGCCGGAGCGGCCTATATGGTTTGGATGTGTGGATTAACCTATCTAAGCTGGC
AGGGAGTCCCTTCCAAGTCTCTGTTATTGCTGGAGCTATTAATCCAACCCAAAGCGTGGTGTCAGGAAATGGAATCCAAGCGAACCGCGTTGCAGGGGTC
GTGACAACGATTCAGCTCGAAACCCGAGATGCTAACATGAACCGCATCTACTCAGGCGGGTTAGCCAGCCAGCTTTCGTTGCGCGCCATCCACACGACGA
ATATCACGGCGATCGAGACTGGAGTCGTAACCGACAACGGAGATGGCACGTATGTGTTCACATACACTCCGAGAGTTGCTGGCGCGTATCGTGTCGCCAT
CACGTTGAATGGTGCCCACGTGAACAACAGTCCCTATCTCGTTTCTGTGGTGCCAAACATCCCGGTTGGATCCACAACCACAGCATCAGGAACAGCTCTT
GCTTCCGCAACGACAAATATCCAGTCGACATTCCAGATTGTCACGAGAGATTCATCCGGCAACTTGGTTGTGCAAGGAGGCGCATCTTTCCGAGTTGTGC
TTGCTCATGCGGTGAAAGGGAGCGTGAATGGCACGTGCACCGACCTTCTCAACGGTCAGTACACGTGCTCGTATCAGCCCAAATTCGTCGGAACTTCTAG
TCTCTATGTCGACTTGATCCGCAACGGTGTCGCAACGGCCATTTCGGGTAGCCCTTTCACTGTCGCTGTCGTCGCCGGACCAGCACTCGGGTCGTATTGT
ATTGTCGAAGGCACGGCGTTGGTATCGTCGATCGCTGGAACTCGCGCAAACTTCACTGTTCGCATCCGAGATTACTTTGACAACGACAAGTCAAATGCAG
GTCAGGAAGCAGTCAGTGTTGCCTTTTCTGGCCCGGCGCCTTCCACTGCTGCCGTGTCAAGCGCAAACGCGAGCGTCACAGTGCAATACGCTGGCGATGG
CGTATTCAATGTATCGTACTTGATCAAGATCAAGGGGTCTTACACGATCCAGGTTCAGGTGGATGGCGTCAGTGTCCGTGGCAATCCGTTCACAATGTAC
ACTTACCCCGCTGAGGCTTCGCCTGCAACGAGCACGCTAGACCTGCTCACACCACTGCTGGCAAGCCCACCAGCTCCGTATTACGCAGGCTCACTCATCA
CGTCACGGCTCACTACGCGAGATGCGTTCGGCAACGTTCTCGAGTCCGGCGGATACAAGTTTCACTTACAGAATGTGACTGAAGCGATGACGGCCCCACT
TGTGGACGAGCGGAACGGGAGCTACCTGCTCACGCTGCGTCCAACACAGTCTGTCGTCTACCCGTTCCAACCAAAGCTCTTGCTATCTGGCGGCCTCAAT
GGAACATACTTTGGAACTCCCGACCTGTCCGGGTCGCCAAAGTTACAAAGGCTAGACACCGCGTTCGATTTCGACTTCCAGGTGTATCCACCGACGTTCA
CCGATACAATGAGCGTATTTTCGGCCCGGTGGCAAGGTTTCCTGCTTCCGCAATTCAGCGAGGTGTATACCTTCACCGTGGAAGTTGAAGGTGGGGTCGC
TATGAGCGTCAATGGATTGTCACTGATGCCAGCAGACATGTGGCCAGCAAGTAAGCGCGCGTTTGGGAGTGGCAGCCTAGCTTTGATCGGGAACGAGCTC
GTAGCCATCGAAATCAGCTACTCCAAACCTGCTGCCCGACCCAACGGCGCTGTTCGTGTGTACTGGCAGAGTTTATCCCAGCCTCGCCAGCTTTTACCGT
CATCGCAACTGTTCACATCTTGGAGAATTGTGAACAACGTCCCGAGTCTAGCAGTTGTTCCCGCGCTGACATCGCCTCCAGCGTTCACAGCGGAGTTTCC
GGCTGGCTCCACGGCGTCCTTACTATCTGGCGGCTTCAAGGTGCTCGCCACTGTTGGAAAGAAGATTACATTCCAAGTTATTGCACGCGACGAGTTCGGG
AACCGGCGGCGCAGTGGTGGGGACATGTTATTCGTGTTATTCCCAGAACTCGCGAGCAGCTCAGCCATTTATCCCAGCATTGTCGACTTGAACAACGGAT
CGTACAAGGTTTCCTTCACGCCAGTCCTCAGCGGGGAGTTCTTCATGGTCATCGCCGCCACGGCGCAAAACGTGAACGTCCCCACGACCGCTGGAGTTGA
TGCACTCGACATTTTCCTGCGTGACTACAACATCCAACAGAGTCCATTTACGATGGCGGTCGCACCGAATGTTGCCACGGGAGTCGACTCAACGATGGTA
GGCGCGGGCTTCGCGTACGCTACCGCTGGAGTCGAGACTTGTTTCCAGCTCCAGCCTCGCGATCTCCGGTCGAATCGGCTGGCGGCACCGTCCATCAAGC
CACTGGAGGCGTCATTTACGTTCAAGAGTATCAGAGTGAAGCTCGTGAGCGGGTCATCAACAGTCGTTACCGCACGAATCGACGAACAAGCGACCACCTC
TCCGCTACCGTGGCTGGAGCTGCCTGTGTGCTACAATGCGACTATCACTGGCGTCTACCAAGTTCTCTTGAGCGTCGATGGTGGAGCAGTGTTCGTCCAG
AAGACGGCGAGTCTGAGGGTGTATCCGAATGTTGCGTCGGCCTTGACATCCACTCTCAATGGCTCTGGAGCTGGCTCGCAAATCACGGCCAATCGGTTCT
ACACGTACCAGATCATGGCGCGAGATGCGTGGGGGAACCCGCTTGAGACTGGTGGTGACCGATTCGTCGTGCAACTCCGCGGTCCGCAGTCGGCATGGGG
CACCATCGCCGATCTCGGCACAGGACAATACGTCGTGACATACTTGGTTGCTCTGCCGGGTGAGTACGAGCTCGAGACACGGCTCGCTAGTCGGCAGCGC
GGCCTTTCAGCCCAGTACTTCGGCGACTCGACAGCGGCAACGGCGCTCCCGGTTGTGCGCACAATTGACGCGAACCTTGACATGGACTGGTTCGTGGAAC
CGACGGCGAAGACTCGCGGTTACCCACGCATCCAATGGCAGGGCTACCTCTTGCCGGCATTCACCGAGGTGTATACGCTCCAGCTCGAGGTCTTCCCGGC
CGCCATCGTTTCCATCAGCGGCGCCGTCATCTTTGACGTGTTGAATACGCCTGTGACCGAGGTGACGACGCTGACTGCGACCGTTTCGATGGTCGGCGGC
AGACTCCACCCGATCCTCGTCGAATACCGGTCGCCAATGCAACGGGACGCCTTCGGGCGACTCAGACTAAGCTGGCAGAGTTCATCGCAGCCGCAGCAGC
TCATCCCAGCCACGGCGTTCGTTCCTGCGGCCCATGAGCTGCTGCCTCG