Description :
From Genome Similarity Track
Location :
Scaffold_69:171350- 172508
Transcript NameFunction/comments
Physo_139029hypothetical protein

Sequence
1158 bases(100 bases per row)
GACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGGCAGCCGCTTTCAACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCA
GATGCTTGGATGCCAGCACTTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGCGACGTCGTCGTGCGA
CTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCCGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGC
TCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCGGAGTACGGGACCATCGTGCAGTCAAAGACGGCGG
CTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGTCTTTCGCGGCGTCAGGAGAGTTGCTCCGAGCCCCGGCCTGACAGCCACT
CTTCGGCGTGCTGCTACGAGAGCGCACCGCCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTC
GGCCGTATGGCCCGCGGTTTCGAAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGC
GATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATATCGACTTTGCGAGTGAAATGTGAGTCGCCGGCG
TAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAATGGGGTTACATGGAATAGTGACCCTGTCACTATTCAGGGATGGCTAC
ATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTTGTATGACACAAACTATAGGGAACTTGGGATTTGTATGCAGGCC
AAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCATTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTT
GGAGTTTGTATACTCCTGCTTCCACTGTTAAGAAGTGCTGTGTGCCCTGTCACAAGTA