Description :
From Genome Similarity Track
Location :
Scaffold_13:17134- 18403
Transcript NameFunction/comments
Phypa_INRA-310PPTG_07732hypothetical protein

Sequence
1269 bases(100 bases per row)
GGACAAGAGCAGGACCTCGAGTCAATTTCCCCCGAGAGCTCCCCGGTTAAGTCGATAAGGTCCAGTGACTCCAGAGCTTCGACGGGAACCGAAGGCAGCG
GAATCGACAGCAGCAGCAGCAGCTCATCGACGTGCTCGTCGCCCGAGCAGCTCGCAGGGAAGACTTTGCTCACTGAGGAAGCGAGCCCCTCGGGCGACAC
TGACGGTGCCACGCCATTACACGTTGCGGCTATGCACGGACAATTGGAGACCGTCAAGGTGCTCCTGGCTCGCGGTGCTAGTCTGTCGGCTGCGCTGCCG
GGTGGTGCGACTGGGTTACACTTGGCATCGGCATCGGGCTTCGTTGATGTGGCCTCGTACCTGATTGACCAGGGCCTGCCAGTCGACGAGCCCACAATAG
CCGGCACAACGCCGCTTCATGAGGCTGCATACCAAGGACACGTCGAGGTGGCCGCACTACTGCTAGATCGTGGAGCCAACGTGGATGCAGCGACTGAGCG
CGGCACGACGCCATTGCATCGAGCAGCTGAAAACGGTCACGTGCAAATTGCTGAGCTGCTGATCGCCCATGGAGCTCACATCGATGCTGTGACGACGGAT
TATCTCGCTGCGGCTGTGGATAGTGAGGCAGCGGGTGAGAATTCTCGCCGGCGACGACGTCGGAGACGAAAGAAGTCGGTCGCTGTGGAAACGGGAGGAA
AGGCATTAGCTGAAGAAGCGCCCGAGACGGAACCGCGAACTCCGGATGAGCTAGAAAAGGAAATTTCGTCCTGCAGGTCTAACCAAGTCGCGCTCTGTTT
GGCAGCCAAAAACGGTCACTTGGATATGGTGCAGTATCTACTGACACGCGGTGCAGCTAGCGCGACGGATCTTGCAGCACTCGAGCCATCAAGACACCCG
ATTATGCTGGCAGCTCGACGCGGGCATCTAGATATTGTGCGTTTCCTGCTCGCTCACGACGAATGTACGTCCAGCCTGCCCGACGCAGCGTCCCGCGTGC
TGTGCTGTGCAGCGGAGCATGGTTATCTGCAGATGGTAGAGCATGCTTTAGCTCGAGGAGCCGATATTGAGGCCATTGGTGGCAAGAAGCAGGCTACGCC
GTTAGTTCTTGCAGCTCGACAGGGCCACTTGGCTGTCGTGCTTCACCTTCTGTGGGGCGGTGCGAAGATTGACGCTGCCACTGCATCCACAGGCTACACA
GCTCTGCATTATGCAGCTAAGCACGGCCACCTCACGGTTGTCAACAGCTTACTCCTCAACGGTGCTGAT