Description :
From Genome Similarity Track
Location :
Scaffold_285:17130- 18995
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_285-fgenesh-gene-0.5Glutamate-rich WD repeat-containing protein

Sequence
1865 bases(100 bases per row)
GATGAGCACGAGAACCTCGTGTTCGAGGACCCGTTCGGCGACGACATGGAGGACGAGGAGATGGTCGAGAGCGACGACGACGACGACGAAGAGATCGTCG
ACGGCGACCGCGACGACGACGGTGAGGACGAGGACATGGAGGGCGGCATGGAGGACGAGGACGAGCAGAAGCAGATCAAGCGCGTGTTCATGCCGGGCGT
CGACAAGCTCGCCGACGACGAAGTGCTCGACTACGACAGCAGCGCCTACGACATGTACTACGCCATGACGGCCGAGTGGCCATCGCTCAGCTTCGACATC
GTGCGCGACAACCTCGGCGCCGTGCGCACGCGGGTGAGTACTTGTATCGTGTTGCACGTGATGGCTTTTGTTCAGTGTACTGACGTGTGTGCTTTGTGTC
TTTAGTTCCCAATGTCAGTGTACCTGGTCGCCGGCTCGCAGGCCGCCAACGCGGACGAGAACCAGATCACAGTCATGAAGATGTCGGAGCTGCACAAGAC
CAAGCACAACGAGGACTCGGACGACGACGACGACGAGGACTCGGACGACGAGGATCGCGTGGACGGCGACCCGGTGCTCGAGAACCGCGCGATCCCGCAC
AAGGGCGGCGTGAACCGCATCCGCAGCATGCCGCAGGCGTCCAACATCGTCGCGACGTGGTCCGACACGAAGAAAGTGCACCTGTGGGACATCGCCAAGC
AGCTCGAGTCGCTCGACGGCAAGGCCACGGCCCCGCTGCCGGCCAAGCAGGCGCCACTCTACACGTTCCATGGCCACGCCGATGAGGGCTTCGCCATGGA
CTGGTCGCCCGTGCAGGCCGGCAAGCTCGTGACTGGTGACTGCAGCAAGTTCATCTACGCCTGGAGCAACAGTGAGAGCGCCTGGAGCGTAGACAAGGTC
CCGTTCACGGGCCACAAGGCATCCGTGGAGGACCTCCAGTGGAGCCCGACCGAGGCGAGCGTGTTCGCGTCCTGCTCGGCCGACCGCACCGTGCGTATCT
GGGACACGCGGCGAAAGGCTGGCAGCATGATCGACGTGGCGGCCCACGACGACGACGTGAACGTGATCGCGTGGAACCGCAACGTGGCATACCTGCTGGC
CTCGGGCTCTGACGACGGGTCGTTCAAGATCTGGGACCTGCGCAACTTCAAGGCCGAGAGCCCCGTGGCGCACTTTCGGTACCACACGGCGCCGATCACG
TCGCTGGAATGGCACCCGACCGACGAGTCTGTGCTTGCAGTCGCCGGCGCCGACAACCAGATCTCGGTCTGGGATATGTCGGTCGAGGAGGACGACGCCG
AGACGGCCGCGACGGTGGACCCGGAGAACCCGAAGCTCGACCTGCCGCCGCAGCTGCTCTTCATCCACCAGGGCCAGTCAGATATCAAGGAGCTCCACTT
CCACAGCCAGTGCCCCGGCGTGCTCGTGAGCACGGCCAGCGACGGCTTCAACGTCTTCAAGCCGGCGAATATTTCTTAAACCCCACCACCAAATACAACC
ATGTCTCTGTTTTCCTTTCTCGCTGCTTGGCTTGCTCGTTTTATTGATGCGAGCAGCTTCTCGACGACCTGAAGGAAGTGATCGAGAGAGAAAGAGAAAG
TATGATGCGCAGGAGATCCAGTTGTACCTGGCGAAGAATAACGGCACGTGCTGAGCGTGAACAGCGCCAAGGAGCTAACACGAGAGGAGCTATCAATGAT
ATTCCTCTACATCGGTTGGGGAAGTCGAGGTACAAACAGCTGAAGGAAGGCGAAGATCACGTTCTTTCGGCGTTTTCCAAGCGCATATCACATGATACTG
ACGGCGCATTGAAAGCGAAAGGTTGATGAGTTATGCGAGCACCTTGAAGAGTAAAAGCACATGCG