Description :
From Genome Similarity Track
Location :
Scaffold_259:1713- 4070
Transcript NameFunction/comments
Phymu_g7657hypothetical protein PHYSODRAFT_345098
Phymu_g7658DEAD/DEAH box RNA helicase, putative

Sequence
2357 bases(100 bases per row)
ATGTGAGCGTTTACGCTGCTCCTGCGCGAGCGTTTTGCTGGATTCGACACCATGGGCTTCTCGCAAGTGTTTTGCGGCCTTGGATGTCTTGCCACCTGAC
AGGGTGAAATTTTTGTGTTGGTCGCGGCATACTTGAGTCGCTAGACAAACCCACTTGAGCGCGTGGTCTTGGTTTTCCTCGCTACCAACCCGCACCCCCC
AGTTAAAGATAAACGatcgtttcttcttggttggAAGCCGCAGCATGGTGCCGTTCACGGGATTGAAGTTCTCTATTGCTGCCGCCACAACAACAGGCAC
CGAGCTCATTTTGGCCGAAGTGGCTCAAAGATCGTCTGTTTGGGCTCCTATATCTTGATGGATTCCATTGATTTAGATGGAGCCCAATTTTAGAGCTGCT
TAATTATTAGAAGCTCAGATTTGCAAATACCGGACTCTACAGACAAATAGAGTCGGTAAAACCGATACTTCAAGACTCGGTTCGGTGATAATATCACGAA
TATTATTCATCCATGGTGTTTATTTTCGGGGTGTATACTAAGAAAgtgttttttattttacttTTGCAGAAAAGACTTTTACATCGTACCAAAAAATAGG
AACAGTGATTGCAACCAGCAAAACCAAGATGGCGATGAGGAAGGCACCAACCGCGCCgactcgcagcagctcgcgcaccGTTAAAGAACGTcagctcgct
ctcgttgAGGACCCCGGTCAAGCGATACAGACTGTTGGCGCGCGCGAGCTccaggtggacgacgactggGAGGAGCGCCTCAATCTGGAAGTCAAGATCA
TGTATGGAGCAGTGTTTCTTCCACTTATAGCAGCATGGCGCACTTCAGTAAACGCTGTGAATTTATACAGGAATGTTGTAGGTACTGTGGACTTAAAGAC
GCCGCTGGACCTAAAGACGATCGCGCTACATGCGCGCAATGCTGAATACAATCCCAAGGTAGGACCGCAAACTGGTTTTGACGTTCGTAGTTCTGGCAAA
GAACTTACATGTAACCATTATTTAATGTTGCAGCGCTTTTCAGCCGTTATCATGCGACTACGTGATCCCAAGACGACGGCACTGATCTTTGGCTCTGGGA
AGGTAGGTCATTTTTGCCAACAAGGAATTGCTGTAAATCTATGATGCTGACTCGTTTGTCACTGCACAGATTGTTATTACGGGCGGAACCAGTGAGGAGA
GCTGCAGGTTAGCAGCGCGCAAGTTCACCCGCGTAATACAGGTCGGCAGTCTAAGTTTAAAACTGCTAGTGAGTTAGTGCTGACAGGCTCTTTGCCAATT
CGTAGAAACTGAACTTCCCAGCCAAGTTCACCGAGTTCAAAGTGCGCAACGTGATGGGAACGTGCGACATCCGCTTCCCAATTCGACTGGAAGGGCTGCT
GAATGATCACGCGCGCTTCTCCAGTGTATGTATTTGCTGCAGTCCAGTTACGGAGTTGAAACACACTTATTTTgttttattttgttttggaACAGTACGA
ACCGGAGTTGTTTCCTGGACTCATCTACAAGCTCGTGGAGCCCAAGCTGACGCTACTCATCTTCGTGTCTGGCAAAATTGTGTTGTGTGGCGCAAGAGAC
TCCAATCATCTCCACCAAGCTATCGACAAGATGTATCCTGTGCTGCTTCAGTACCGCAAGATGACGGCACCACCATCGCTGATGACAGGAAGGCCAGGGT
ACGAAGATAGCGAGGATCTTGACCGTCTAGAGCCAGGGGCTAATGTCTAGAAAACGACGCAGTACGAACGTGCATTGTCTATCCTTATCCTATGCAGCAA
GAAATCAACGAAAacacaaaacaaaaatgTATCATTATCCATTCTGTACCTAGCGGGCTTTTGGGTCAGACTGACGTCCTTCGCAGTGCTAGCGGACAAT
TTGTATTGTTTGCATCTATCCGTTGCACGAGTGTGTTCACTCGCTcttcgggttcttcttgtattttttgttcttcttgccgtcaCCAAGTTTTGAAGAA
GTTTCTTGAATGTTCTCGACTTTGTTTCCGGGGTCTGACTGCGAGTCGCCACCCTTGTGTTTCGCTTGTTTCATCTGCCTCACACGGTTGGCCTTTTGGA
GGTCGTATCCAGACACGGTGTTGATACGGTGACGCATCGGTGGTGCCTTCAGGAGCTCCTTCCTCTTTGATACACTATCGTGAAAATACAAGGTAAGTAA
GCTACACAACAAAACTAAGTCACATCGGCAATTACTGCGTACCTGGCCTTCTTCAATGAAAGCATCCAACCGGGGACCTCGCAGCCCGAGATCTTCATCA
CGTTAGCGATTGTACGCAGGTAAACCATATCATCTTCGGTGAAGAACGTGACAGCCT