Description :
From Genome Similarity Track
Location :
Scaffold_100:17125- 22253
Transcript NameFunction/comments
Phyag_g2040callose synthase, putative

Sequence
5128 bases(100 bases per row)
CGAGCTGTTGCAGGCCAAATTTGGCTTCCAGGAAGGCAACGTCCGCAACCAGAAGGAGCACTTCGAGTGCTGGGTGCTCAACTACGAGTCGCGCATCCTC
GAGGCCGCCGTGACCCCCGTGGACACGGAGCACGCCATCGAGACGATCCACGCCAAATTCTTCCGCAACTATGTGAAATGGTGTCAATTCCTGCGCACGC
AGCCGTTCCTACTGGACACGGCGCCGTATCCCGGAGCTGCGGAGCGCCAGATTGCACTGTTCTTGTTGATTTGGGGCGAAAGCGCCAACTTGCGCTTCGT
GCCCGAGTGTCTGTGCTTCCTGTACCACAAGATGGCAGCTAAATTAGACGGACTCGAGAAACTGCCCAATGCGCCGGAAGGCACCTTCTTGCGCCGCACT
GTGCGGCCATTGTACGCGGTCGTGGGCAAGATGCGCAACGTGACGCCGCAGAAGAACGGCGCTGGAGTTGACCACAAGAACGTGACCAATTACGACGATG
TGAACGAGTTCTTCTGGAGAGAAACTTGTTTGAATTTTGACGAGTTTAACGTGGCGGATGCGGTGAATGTGCGCGACTACAAGACATTCAAGGAGCGCCG
CAGTTTCTGCAACCCCATGTTGGCGTTCTTTCGCatctacttcttcttgctggtgatgctgcaCATTCTGGTAGTGATCGCCTACGTGGCGTATCGCTCG
GACCCCGACGACACTGACGGGTTCAAGTTCTACAACAACTTCTTCACGTCCGACATCAAAGATATTCGCAATCACGCTTTCTACTCTATCTTCATGACAA
TCAGTGGACTGCTGGCTGCTAAAGTGGTGCTAGATGTCTGGATTGATGGCACGCGCATTTTCAGCCGCATCATGTACGCAGTGTCGGTGTTTATCCGTCT
TGTATGGCATGCGGTGTTCTTCGGCCTCTTCACGGCTGTGAATGCGGCCCCGTACAAGACACTCGGCTCGAGCGATTTGCTTACGCTGGCACCCACTATG
GCCGGTGTGTACATGGCGCCCATCGTGATCGTGTCGATCGTTCAGATGCTCTTCCGCGGCGTTATCTGGCGGTCGGCCTTCCTGAGTTCAATGGACGGAA
CGCGTGAGCAGTACATCGGTCGCACGATGGGCCAGAGCTGGGGAGAATTCATGGGCTACGGAACCTTCTGGACGATTATTTTTGTGTGCAAGTTCTTGTT
CAACTTGCAACTTATGGTGAAGCCACTCATTGGACCCAGTGTCGAGATCTACAGTGTGGAcgtttctgctgctcagcTCGAGAATGGTATCATCGAGTCG
GACCATAACATTGCTTTCCTGGCTGCGATGTGGGCACCCGTGTTCCTCGTGTACCTCTACGACTCTCAGATCTGGCTGGCTATCGCGCAGGCTATCGTGG
GTGCCTGGATTGGGTTCCGTCTCAAGATCGGTCACTCAGCTCGCATTAAGGAGTTTGTGACACGTCTTCACCAGGCGCCCAATCTTTTTgacgagaagat
cgtgtCTGCGGCCGCCCGCGGTCAGCTCGCAATTAACAACAACCCGCTGTCATCGAGCTCCGTTGCCCCTGATGCTAACAGCCGTCTGCggtttgctgtt
gtgtggAATGAAATTGTGAGCAGCTTCCGCTTGTCGGATTTGTTGGACGATCGTGAGACTGCTATCCTTCAGTACCAGATCTCGGACACTGGTGCCGTCG
AAGAGCCCGTGTTTTTGATCGCTGGTGAGGCGCAAGCGGCTGCGGACATTGCTGCCAGGTCTAAGACTAAGCGCATGAGTGATGGTCAATTGTTCAAGga
cctgaagaaggcggGACTACTTGGCTGCGCTAACAACTGCGTTGACATTCTGTTTCAAATATTGCGGCAGCTTTTGGGTCCTCAGGACTCGGAGCTGGTT
GGTGTGTTTCACCAGATCCTGGCTGGAGGCAGGGTGAGCGGTGTCGTGAACCTCACTCACATTGGATTGGTGCGCGAAAATGTTGTCGATTTGCTTGCAA
GCATCTTAGACCTACCGGAACCGGGCGTTGTGCCGTCAGGCGGCGCTTTTGGCTTTCCGCACGATCAGGTACTGgtcgtcgtgcagcgtgTAGATGCTCT
GCTGAAGAGCATTGAGCTcatgctggaggaagagtgGATGGCGGAGAAGCTACGTAAGTCTGCGTTCGCCAAGATGACGCCTGATCTTGCTTATCAAAAG
gagcagttgctgtcgatCTTTGCCGACCGTATCAGCCAACGCGACTCTAACTCGCCTACACGCACGACGTCGCCGAGCTCGAATGAGAGCGTGGTGTCGC
TCTCCACGCGACTATTCTTCTTGCTGACCCTGGATGCAGCTGACGCGCTACCTCGTTgccacgaagctcagcgccgcatgagtttcttcttgaactcaTT
GCACATGAAGATCCCGACCATTGACTCCATTGCAGCAATGAAGTCATTCTCCGTGGTCACACCCTACTACAACGAAACAGTGTTGTTCTCGGTGGATGAA
CTGAATGGACGTGTGGACTCGAACCCGCTCTTCCGGAAGGTGGAGCAAAAGGGCCGCGACCTCAGCATTCTGAAGTACTTGATCACattccacgacgacg
aatgGGGCAACTTCCTTGAGCGTGTCGGCGTGGCTTCCATGGACGAGGCCCTTGCTGAGACGCCGACACAGGTTCGTCTTTGGGCATCTATGCGTGGACA
AACCTTGGCACGCACGGTGCATGGTATGATGATGTATGAAGACGCGCTGAAGATGTTGCGCTGGCTGGAGATTGGCTCGGACGAAAACATCTCGCacttg
gagaagatcaagcacATGGATCGCATTGCTGGTCTGAAGTTTTCGTATGTGACCAGTTGCCAGATTTACGCTGATCAGCTCGCCGCAGGAGACTCGCGTG
CTGCGGACATCGACTTGCTCATGCGCAAGTACCCGAATTGGCGAGTGAGCTACGTCGATACGATTCGCCCACCCGCTGGCAGTGGCACAGAACCTCGTTT
TGATTGTGTCCTGGTCAAATCGGATGGTGACGAAATCGTCGAAGTATACCGTTATGAGCTGCCTGGCAATCCATTGGTTGGTGAGGGTAAGCCTGAGAAC
CAGAATATTGCCCTGCCCTTCACTCGTGGTGAGTACGTGCAAACGATTGATATGAACCAGGAGCATTACTTCGAAGAAGCGCTCAAGATTCCGAACTTTT
TGGCGACCGCTACGGAAAATGGACAGAATGTCACCATCATTGGTATGAAGGAGCACATTTTCACGGGTCGAGCGTCGTCTTTGGCACACTTCATGACGTT
GCAAGAGTTGGTGTTCGTGAGTCTGACGCAGCGTGTACTGGCGAATCCGCTTCAGAGTCGTATGCACTACGGTCACCCGGATGTGTTCGAGAAATCGTTT
ATTATGTCCAATGGTGGTGTTTCCAAGGCCAGCAAGGGTATCAATCTGTCCGAAGATGTATTCGCTGGTTACAACGTGGCGCTTCGTGGCGAGAAGGTTA
CCCACCAGGAGTTTATGCAGTGCGGTAAGGGTCGTGATGTGACCTTGAGTCAAATTAACGCTTTCGAGGCCAAGCTGTCGAACGGTAGCGCTGAAAGCTC
GCTGAGTCGCGAGTCACACAGAATGGGGGCTGGCATGGACTTCTTCCGGCTGAATTCGATGTTTTATGGCCACATGGGCTTTTACATTTGTAACGCATTG
GTGGTGTTGTGTGTGTTCGCATACGCGTATGGCAAGGTGTACATTGTGCTGCACCAAGAAATCGAAGAATCTGCCATTATCACGACGAGCTATTTGGATG
ACCTCGCTGAGGTGATGAACACCCAGTTTATCTTCCAGTTTGGTATGCTGATGACCATTCCGTTGATCGCCACGCTGTTTGTGGAATATGGTTGGCACCA
GGCCGTGGTTAACTTTGTGGAGCTGATTGTGACTCTGGGTCCAGTGTTCTATATCTTCGAGACGGGCACGAAGTCGCACTTCTACGATATCGCTATCATG
CGCGGTGGGTCGAAGTACCGTGGTACAGGTCGTGGGTTTGCCATCGTTCGTGAAACTATGGTGAACTTCTACAAGGAGTACGCAGCTTCGCACTACCGCA
AGGCAGTGGAGCTGATGGGTCTTATGATCATCTTTGGTACATATGGCAACTTCGCCATTGGTACCAATGTGCTGGCTGAATACTGTGCCACTGCCGATTT
TGATTGTGACAAGGACCCCGACCAGATTCCGTCAAACATCACTCTTCTTAACTCGTACAGCTCGAAGGGCCAGGACTATGGCATCGCTTCGTTCGCTGTG
TGGTTACTCGGCACGTGCTGGTTGCTTGCGCCGTTCCTATTCAACACAGATGCCCTGGACTTTTCGAAGACCATAGTGGATATCACGTACTGGATGTCAT
GGCTCATGTCTGTTCgggaagaggaagctgacGAAAGACTGCTCCCGAACCACATGAGCAGCAATCCCTCGGGACCGAAGGATACTTGGAACGATTTCTA
CAATTATGAAGCGACCCTGATGTACCCTATTGGTCCCATGAGCCGTTTCGTCTACGCTGTCCGTGAATCCCGTCACCCGCTGATCATGTACTACATTTTC
ATCTACTCGTTCAGTCTGAGCGACATCGGAATGCTGTTGGCGTGTGTTGGTGCCATTGCTATTTTGCTGTGGATCGGCGGTTTTGGCCTGGGCATGTGCC
TGCGCAACAAGGCACGTGTTCCGCGCGCGATGCTGTATGTGCTAATGGTGTTGATCATTGGCGTCGCTCCGTTTATCTATGGATCCATGCAGAACTGGGA
CGGGATCAAGTCTTTCTCACTGACGGTGGCTATCTTCACTGGGCTATTCTCGCTCCTCCACTacctgcaactgctgcacggACTGTTCGGACTTCCAATT
GCCAAGTGGGGTCTTGTGCGCGAActggccttcttctttgaTGTGATCGTGGGTTTGTTCCTGGCGTTCCCACTGATGGTGTTGTCTGCTTTCCCGTTCA
TGAAGACTATCCAGACCCGTATGATGTACAATGGTGGTTTCTCGCGTGCCCTGAGCTCTGGCAGTGAGTTCGCAGCCTCGCTGAGTGTTGTTGTGGGTGG
CCTTGGCGGCTTCACATATGGTTGGCTG