Description :
From Genome Similarity Track
Location :
Scaffold_283:17120- 18720
Sequence
1600 bases(100 bases per row)
GTTCCCAATCCACCCATCTGCAACCACCTTGCAGATTCGTCGTCAAAATCCTCCACAGAGCGACCAACTCGCTCTTGGGGATCTCAGTCTCAACCTCCTC
GTGAAACTACATTACCCCAAACCGGTTCCGGTTGGAGCGCCCCCGCAAAAACTCATGCAGTATGGCTCCACAGTTCAGATCCGCCTTGTCCACCCAGGAT
GGATCTTCATATCCACGCCAGTGTACCAGGAATTCACGGTGGATCCGGCCGTAACGAGTACGCTTTCCAGTCCAGATGTCAGTAATTTTCTCCACCTCGT
ACTCGTTTTCATCCAGATCCTGGATCCAACTGTCCTCTGGCAGCAGTGCTTCATCAAAATCAAATCGATCTGTAGTGCCTTCAGTCAACTGGATCTGGGG
TCGATCCAGAAAACTCCTCGCAAGCTTCAATTTGGACACATGCATCACATGGAACAGCCGATACTCTGTGCCTGGAGTCTCGATCCGCACAGCGTGTTCT
CCGATCTTCTCCGCTATACGGAATGGTCCGTGCCACATATGGGCCAATTTGCGAGCATACCCTTCCTTCACCCGGTCCAGATACAGCCAGACCCTGGATC
CTACCTCAATCTGGTGCGGATGGATCTCTTCGTTGTGCCGGTCTGCCCGATCTGAGATCGCCCCCTGCAGTCGCGTGTTGACTTCTGCCCGTGCCTGCTC
ATAATAGCGTTGGATCCGGTATCTCCACCGCCGTGGATCCCGATCCTGGCGGCGAGTACTGCCTACCGGGATTGTGGCTTCGAGTGTGGATCTCGGATCC
CAGCCATGTACCAAGTAAAATGGCGTTTCTCCTCGGATCCGATCTTGGGCAATGTTAAGTGCGAAGGTGAGACGCTCCGCGTAATCGTCCCAATCGCGCT
GATCCAGATCGTGCACATACATCTTCAGAGCGCGAGTTGCTGTTTGCATGATGCGTTCGGCGGTTCCATTCGCTTGCGGCCAATATGCCATCGTTGCACG
TTTTCGTTGACCCAGGATCCGGTTGAAGGATCGAAAGAAGTCCGACATGAACCCCGGCTCACGGTCGTGCCGGATCACTTCGCTGGCACCGAATCGTCTG
AAAACACACTCTTCGTAGGACTCCGCGATTGTCCGCGCTGTTCTGGAGTTACTGGCCTTCGCGATCACGTATCCCGTGAACAGATCGACCCAGATCAACA
GCTCCGTATTACCCTTGTACGACTTGGGCGAAGGTATGTGATCCATCGCTATGATCTGGAACGGGTATGTCGCCTGGATGTTTCCCGGCGACTCGCCCCT
GATCGTGGGTCGTCCTTTGCCGGTCTCGCAGTTGGCACATTCGCCGACGTACTTCTGCACACTTCTGAAGAGACCTCTCCAGTGAAAGTGATCGCGGATC
CGCTGGTATGTACGCCCGATCCCTTGGTGTCCACCTTCCAGAGTGGAGTGATAGTGATGCAAGATGTCTTGATGCAGCGTCTCCGGCGGTGCCACCAGTC
TCATCAGTCCATCTCGATCTGCATCCGATCGCTTGGAGGGTGGGCAATAGAACAGCAGATTATCACCGTCGATCTCGTAGTCCGCTGCGAGGTTGCCATA