Description :
From Genome Similarity Track
Location :
Scaffold_48:171188- 172756
Transcript NameFunction/comments
g10016.t1XP_008906196.1 hypothetical protein PPTG_12235 [Phytophthora parasitica INRA-310
g10017.t1OWZ23135.1 hypothetical protein PHMEG_0002032 [Phytophthora megakarya

Sequence
1568 bases(100 bases per row)
ATACGCACCGCGGCTCTCGGTGTACTTGCTGTTGCGCCGCAAGTCGTGTATTTCGTCACAGCAATGGTGCCCTATTGTCCGTCACTTTTCCAGCGGTTCG
GCGGGGAGGTGTCTGGGAATGCCTCTATGGAGGACCGCAGCTGGTGTGCCGAGGTGATGCCCAACTTCTCCGCTATGTACATGTTCATCCAGAGCGAGTA
CTGGAATGTGGGCCTCTTCCGCTACTACGAGCTGAAACAGATACCCAACTTCCTCCTTGCTGCGCCGATCATCGTGCTTAGCTTGCACGCGCTGCAAGGG
TATTTTCGAGGTAGCGTCGTGCCAGGACGAGCTAGCATGACATCTCAGCAGCAAGGTCGCGGTTGGCGAGGCACAACGCTGACTCCGTATTACGTGCATT
GGCTTTTCTTGGTGGTGAACGCGCTGCTTGTTGTGCACATCCAGGTGACGACACGGTTGTTGTGTGCCTGCCCACCGTTGTTTTGGCACCCTGCCGAGTT
ACTGTGTGACTCGGTGGCAAAAAGGAAAGCTACATCCGGCCTGACAATCTACGGTCGACTCGTAGTGGGCTACTTTCTGCTCTACACGGTGCTGGGGAGC
GTGCTCTTCCCTTCCTTCTACCCGTGGACATAGTTCACAACTTGGGATCGAAACAAACGAATGACTGCATGTTTCGTAGCAAAATAATCATCCTCCACTA
GACCCCCCAATGGTGCGTTCCCATATATCCATAATACCTTTACGAGCTGCGCTCTCCTTCGCGAAATCTTGTTTTCAAGCTTGGTCGTTTTCACCGCAAC
GACGACTTCTTGATTTTAAGCTTTTTCGCCAGACGATCGCGCGCTGAGCTGGTCTTGCGTTTGCGGCCACCATGATCGTGTCTATTGTGGCTACTGTAGC
TGCCACCTCCCCCAGACGGCGGGGTGAGAGGTAGCGGGGGCCGTACGTCCACAGGCCGCGAAGACGAGGTCTCCGTTCTCGCTGAAGCAGGAGAATAACC
TCGAAGCATCAGCCCTTTGCCTCTTGGTGATGGCGTCACGGCAGCTGGAGGCGGAGCATTATGCTCCACATCGCTCGATTCCGAGTGCGAATGCGTCTTC
CTTGAAGGCGACGAGCTGGTACCTAGCGGTCTTCCATGCTTCTGATGCGAAGTCGTAGATGAGCGTCCTCTTTCTCTCTCGTCTCTGCGTTTCACGCGTC
CGTGGCTGCGATCACGTCTTGTAGACTCAGACGACGCGTGTCGAGGCGCAGCCGACGGTGGTGGCGGCGTTGGTGGTGGTGGAGGAGGGGTAGACGGAGG
AGAGACAGCCGGAACAGGAGGGGGCACCACTTGAGCGAGTGGCGCTCTTCTCTCCGTCTTTGGCGATTGCCGGGTTTCAGCACGTCTACTCCTGTGCGTA
CGAGTTGGAGTTATCAAGGTATCGATCGAACGAGCAGATGACCGCACATCCACCTCAACCACAGCAGATGCATCTTTGCTTTTTCGCTGGTGTTGCGACG
ACTCAGTGTGACTTCGCTTGCGCTGTCTTTCACGACTTCCGCTCCCCTTCGACGCAGACTTGCGTCGA