Description :
From Genome Similarity Track
Location :
Scaffold_31:171152- 175062
Transcript NameFunction/comments
Physo_134325hypothetical protein

Sequence
3910 bases(100 bases per row)
GCGCCGCGCCAAGTCAGGACACAAGAAGAAGCGCGACATCGGACCGAGCTACGAGCCGCCCGACCCGACGCGACCGACCGGCATGGAGGGCGCGCGCCAA
GGCCTGTTCTCGCCCACGAACGCCGACGGCTTGGGCCCCGCTGCAGCTGCTGCGGCGGCCGCAGCGACGCCCACGACGTCGCGCACGCGCGCGTCGCTCA
GCAGCAAGCTCAGCCTGGCGCCCGACGACGCGTTCGCGCGCGAGCCCGAGTGCGGCGTGTGCGCCAAGTCGTTCAACATCCTGCGGCGCCGCCACCACTG
CCGCAGCTGCCACATCGCCGTGTGCAAGGAGTGCGGGCGCAAGGCCATCGACCGCAAGAAGCCCGAGCGCTCGCGGCCGCAGTGGTACTGCATGGGCTGC
CTCGAGGACGACGCCACGCTCGAGATCACGGGCTCGCGCCCCACGGTGAGCAAGCGCCGCAGCTTCTCGTCGTCGTCATCGTCCTTCGCGCCCGCGAGCG
CGCCCCAAGTCACGAATGTGAGTGCTGGAAGACTCAAGTTGAAGTGGACTGGACCAGGTGTTTTGGCCTATTGACTAACTGTTTTATTGACTGACTGATG
GGCATGACAGTTGGCGAGCACGGCCAAGTTCTGCATTGAGTGCGGCTACGAGCTGCCGCCGCGCGTCAAGTTCTGCATCGAGTGCGGCACCTCGGTGCGT
CAGCAGCTCATGTCGCCCGTGAGCGTGGACGGCGTGGGCGCTGCAGACGGGGAGCGCGGCAATCGAGGCTACCGCGACTCGCTGACCACGAACCTCATGG
TGATTGACGAGAACAGCGGCTCGCCCACGGAGCCCACGGACGGATCGGAGGATGACGCGCCGGCGGAACAGGAATCGGAGGACGACGCGCCCGTGAAGAA
GAAAGTGGACGTGGGGCTGGAGACTCCCGAAGGAGATGAGGACGCTGCAGCCAGGGCGAAGGAGGTCGAGGAGCTCGTGGCACAGCTGCAGGTGGAGAAC
GAGAAGCTGCGGAACCGTGTGGAGAAGTTCAAGCGAAAGATTTCGGAGGCGGAGCGGCGGAGGCTCGAAAGAGAAGAGGAGCACGCGCGCGCAGTGTCGG
AGGCTACTGCAGCAGCGGCCGCCGCTGCAACTGCTGCCGCTGAAGCGCAGGCGAACAACCGCAGTGCGTCTGAAGCGGCACCTCAAGCAGCATCTGCGCC
ATTCGCAGCGGTAGCGGCACCTACTAGCAACGGCACGGGTGTTGCTGCAAAGGATCACCCGGATTACTTGAAGTACTTCAAGTTGGTGACCATGGGGCTC
CCGGCTGAACAGGTGAAGATGAAAATGCAGGCGGCTGGCGTAGACCCGTCGATCCTTGATGACCCGGATGCGATCATCGGCGGTGCTGCTCCAAATGCAG
ATACTACGTCGGCTCCGCCTGGAGCGACAGGTGGTACCCTGGTGAAGGACGACGAGCAGTACGCCAAGTTTTTCAAGCTTCTGAAGATGGGAATGCCGGC
TGAACAGATCAAGCTGAAAATGAGCGCGAGTGGCCTGAACCCCGATCTCCTCGACACGCCAAATGCTCCGATGCCCGGATCTGGTGCGGCAGCAGCTCCA
GCAGCGGCAGCCAACCAGGTGATGACTGTGAAGGAAGACCCGGCTTACGAAAAATTCTTCAAGCTGGTGAAGATGGGTATGCCCGCCGAGCAGGTCAAAA
TGAAGATGAGCGCGGCAGGTTTGAATACCGACTTGCTGGATACGCCAGACGCGCCGTCACCCAACCAGAAGGCGGCTGGAGGCAATGGAGGCGGCGGTCT
CCTTGCTGGGCTTCCTCCTCCGACAGAAGCGGTGAAGGTGGACCCATCGGCGTTGAAGGCGAGCTTAGCCTCAAAGTTGAACAAGCCAATCCCGAAGAAA
CCCGAGGAGCCTCAGCTTCCTAAGAAGGAAACGGTAAAGCCGAACGTCGAGCTGCGCCCGTTGTTCTGGACTCGTGTGCCTGTCAATGTAGTCAGTAGCA
CCGTCTGGATGAAGCTGAATGACTCACATGCGGAGCTGGACGTGGATGAGATGGAATGGATGTTCCGCAAGAACCCGGTTGAAGCATCGAAGAAGATGGA
TGAAAAGAAGAAAGAAGCGGAAAAGGTACCGGCCCAGCCCAAGGAAGTGCTCCTGTTCGATCCAAAGAGACAGCAGAATGTATCGATCGCCATTGCTCGG
TTTAAAATGTCGTCGGAGGATATCAAGAATGCTATCTACGCTTTGGACGGCCAGAAGCTGGGGTCTGAAGTGTTGAACGTGCTGATTTCGATTTCACCCA
CCCTGGAGGAGATTGATATGCTCAAAAATTACGATGGAGACGTCAAGCTGCTAGGAAACGTGGAGAAGTTTTTCCTTGACCTGCTGACAATCCCGCGCTA
CACGCAGCGTATCAAGTGCTTCAGGTACAAGCTACAGTTCGAAAATCGTATTCTGGAAACTCAAGCGCAGTTGGACACGCTGGTCGCTGCTACTGATCAA
GTGACAGAGAGCGACAAATTCCGCCGTGTTCTGGAGCACATTCTGGCGATCGGTAATTATTTGAACGGCAGCACGCCTCGTGGTGGTGCCTATGGTTTTA
AGCTGGACACTCTGATGAAGCTGCACACTCTTAAGTCTGTGGACCCTCGTGTCACCTTGATGCACTTCTTGCTGCGCCAGCTCGAAGAGAAGGCCCCGGA
TGTCATTACTTTCGCAGGAGAAGTACCACACATTGTCGAGGCGAAGAGATTGTCTCTTGACCAGCTCCGCGCGGATCTTTCTTCTTACAATACCGAGCTA
GCCATGCTGAAGGGCCAAGTGCGCGCGTCAAAGAACGATCACATTGAGGGTGACAAGTTCTATGAAGTGATGACTCCGTTTGCGAAGGACGCGGAGGAGG
TGCTGGAGGAACTGGGACGCGACTTTAATGGGCTGGAGACTTCGTATCAAGAGCTAGTTAGCTCGTTTGGCGAGGATCCACGCAAGGTTGGGCCCATGGA
GTTCTTTTCTATTCTGGATGAGTTTGTCACCGAGTTCAAGAAGGCTTACCGTCAGAATCAGACTAAGGAATACCAGACTATATATGAAGAAGCTGCCGCG
GCTCGCGCTGCTGCTGAGGCTGAAAAGGCCGAGCAGCTCAAGCGGGAAGCTGAAGAACGCCAGCGCCAGGAAGAGGAACGGCAGCAAAACTCGCTCGAAA
CCAAGGCGATTTATGCTGAAATTATGGCTATCATCACCGCTTGGGCTGAAAAGCATTCGCCAGGCAACGAGGAGGCAGTGATTGAGCAGTTCAAGGACGT
CTCGCGGAGATTTGGCATGGACGAAATTACCGCTGATGAGTTCTGTGACCAGGTGCGGCAGTGTGTCGGGTCGAAGTGTGCAGGCAAAATTATTCTGAAC
AGCGCGAAACTTTTGTCCGACGAAGCAAAGCGGAATATTCTGTTGGAGGCACTCGCTCGCTTCAAGGAGCAGGTGAAGAAGGAGAAAGAGTCCAAGAAAC
AACAGCGCAACTCGCTAGTATCCCCGCCGTCCGAAGGACGAGAGAGGGCTGGGTCTTCTTCAGCAGGTCGCAAGCGCAACAAGGTGGTAGTCCCGCTGCC
CATCAAGGACATCGAACCCGTGGTCGGCGAGGAGGCCCAGCTGCTGCACAAATCTATCCTGGAATCCGTGTTGGCGGCATTTGGCGGCGATCCGAAGAAG
ATGAAGTCGTTCACATCTCACACGCGGAAGTACGGCAACGAGCAGATCACGGCGCACGAATTTTACCAGTATTTAACGGACTCCTTCGAGCCAGACTTCG
TCGGACGTCTGGTGCCGGACCTCGCGCGTCTGCTGCAGGATTCGGAAAAGCGGCACGCTCTCATCCGCGCACTATGTGAGAGCGCACCAGGCTGGGCAAG
GTTTGCGGGG