Description :
From Genome Similarity Track
Location :
Scaffold_118:17107- 18874
Sequence
1767 bases(100 bases per row)
GCCGCCGGTACGAGACCAGCCTCGTACTCCGCCACGCAGTCCGGGAACGTCGGGCGAGAAGGATGGCGCGAGGCTCCCAACTATCCTTCATGGGGCCGAG
CCACCGAACGAGGTAGCGCCGGAGCGGAGGGATGGCAGCGTCATGGCGATCAGCGCCGTGACTCGTATGAGCAAGGTTGGGCGCAGCACGAGGGTCCTCG
TGTTCCAAGATACGGTCAACGATATGACGAAGATTACCCGCGCTATCGACAAGAGGAGCGGGACCGTCACGCTGAAAGGGTGGACCGCGGACGGCGGGAA
GACGCTGCGACCGCGCAGCGTCTGGATCGGTTGCTTCAGCGTGTGGAGTATCTGGAGCGGGAGAATCAAGAGCTGCGCCATCGCGTGCGACGTCAGGACG
AGCCTCGGGATGATCGCCGAAGTCCGGACGCGGGGAACCATCCGCGTCGCTGGGGATAGACGAAGGGTGATAGCGGCGGAGGCGACCAACGTAGAAGGTA
GGGTGGAGGCGTAGTGCTGTAGGTAGTCGAAGTGTATACGCGTCACCTAATGCCTTCAATATCTTGAACGGTCCGATATATCGCGGCGCCAGCTTGTTGG
CGCCCAAGTTCGTCACAGAAGTGGGTGTAATGCCGTCGGTGGATAGCAAAACACGATCGCCCACTGCAAACGTCGCGAGATTCTTGCGACCACGCCTGTC
TGCGTTCTCCTTCTGGCGATCCACCGCCATAGCGATGGCGTCGCGCACATAGCGGATTACCGACTCGCGACGCTGGACGAATGCAAGAGCGGCCGCGGCA
TCACGCGGTAGCGATTCAGGGTTCGGATTGAAGTTTGCGGGCGGAGGCTCGGGTGAAGCGGCTGAGCCTGTCGCGGCATGGTACTCAACTGCGTGGCGAT
GCTGACGCGGGTTAATCAGCGTCCTGGACGTCCAGGTGGTCAGTGAAGATGGTGTTGCCTCCGTGGCACCACGCGTGCGCACACTTGGCGCAGCAGATGC
GGCTCCACGCCGGGTGGTGACAGCATTCAAAATCGCGGAGGTGACGTCGTGAGCTTGCTCACGACTATCGTCAGCGGGAATCGCGGATGGGGCAACATCG
GAGGCGTCCGTCTCGTTCGGTGGGGGTACTGGCGCGGGCGTGACCGCGTCCGATTCGACTGGGGACCGACGATCCATGCCAAGGAGGGCAGGGACGCGGG
GATGGCGTCCGTAGTTCACGTAGAATGGAGTGAGCCCCGTCGATGCGTGAACCGCATTGTTGATCGCGAACTCGACCATGGAAAGGAACGAGCTCCAGGA
CGTGAATGACGTGGCGAAGCTCCGCAACACGTCCTCAACGACCCTGTTCGCACGCTCCGTCTGGCCGTCCGTTTCCGGATGCGACGCGGTGGACATCTTC
AACCGCGTCCCGACAAGCCGGAAGATCTCTGACCAGAAAGCTGAGGTGAAGCGGGGATCGCGATCGGAAACGATCGATGTTGGCAAGCCGTGATGGCGAT
AAACAAGATCCAGAAACGTCGCCGCAGACTGCTTGGCGGTGACCGTAGCGGCGACTGGAGCAAGATGGACCATCTTGCTGAATCGATCGACGAAGACGAG
TATGCCAGTGCGACCTTGGGCGTCGCGGGGAAGGCCGAAAACGAAATCCATACTGACGGAGGACCACGGCTCCGAGGCCCCCTGGCGGGGTCGAAGCGGT
GCTTGCTTCGACGGGGAAGGCTTCACGCGCTGGCACGTTTGCATGAGCGAACCCACTTACGCACCCA