Description :
From Genome Similarity Track
Location :
Scaffold_159:17104- 18642
Sequence
1538 bases(100 bases per row)
GTGAGGTAAGAAGATGAGTGGAGGAGGGTCCTACATTTCGTATTGCACTGTGATTGGGTATTTTATTTTTGATAAATTTTAGGGGCCATCGGCACTCTCA
AAATAATGATTTGTTTATCTAGGGGGTATCCACGTAGTAATCAAGGGGTGTCTACCTAGTTAGTCCCTTTTTATCTTCTCATTACCTGGGTCATTTTTTA
GTTTCTAAATATCTGGGGCATTTTCCCCAGAACTGAAATAGAACCAGTGGTTGTAATCGTCAAACTCGACGAGCACAACCTTGCTGCGTAGTTATCTTAT
AACCTGATCTAGCGATAAACCTCACACAAAAATAAATAACTAGCATAATGAAACAATTCTTATTAATTCCACAAACAAAAAGAACAAGCTCGATGCACGC
ATCGAGAGCTGTGAATCATCACGAACCTACATTTTTAACTCGGTTTGATGTAGACAAATTATTTATCTGAATTGGTTTCTATCAAATCTACTAACCCGCT
TTTCTAATTGAGCATAATACATTTATGAGCTATATCTTTTTATAAATGTATCTACTTGGAGTTTCTAGGCGAGTCACTTGTTCTTAAGGATCCCCAATTT
GCAACCCATACTTTAAATAAATCTATTCCGTACTTAAAAACGGGTTGCGATTTTACGGACATGTATCAGGCTTTACGATAAATAATAACGATAGCCAATA
TATAGACCACTCCCTTCTTTTCTAGTAATACCGCAGAAAAATTGCACCCGCTGATTGAGAGCAGTACTTAAAAATTCTCTACGTTCATAATATTTTTGAT
TTCGCTCATTGTACATTTAACCTTACCGGCGATTGGCCTCCAGCAATACATTTGATATGTATCCAAAGAGGAGGACTTCACAAATGACATCTTTAACTGC
TCGAACGATGAGGGCGCTATCTCTGCCACGATAGAAAGATTTTGTTAAGATGCAGATCTGTTTTGACCCTTCGAACATTAATCGCAGTCGCGATACAGAC
GTCGCGATGGTTGAAAAAGCTGATAACAAATTGAAGACCTACGCGATAGCGAGTTTTGGACCGATCTTATATACACCCATTTTATTCAAAATTCATGTCC
TTTATCAAACTAATATTCGCTCCAGTTTTGCCAAATAATTTGTTATACCATGTAACTCATAATCAGTCCCTACATTAACCAACAAAAGGCTCCATATTGT
ATTCCCTACCTTATTTCTATCGAAGTTTGCATTTACCCTAAAGGGGCACTCTCAACGGGGCCGTGTGGGATGAATCTCGTGGTTGAAGTCATCATAGAAA
CGAAGGAATATATCTTAAGTTTAAAACGCCCGTCCATGTCATATCGAAAGGAGTGGTCGTGAGGAGGTGAACGATTTCATTATCGAGGTCATCTCCGAAC
ATCCTCCTATAGAGTAGTGATTACTCACGTACAACTCTACTACAATCCATCACTTCGATGAAATAACTAAAAATATGATCATTTTTATCACAACCGTCAT
GCTACCTTCGTGCTTTTATGACGTCCCTGTTTTCCTTC