Description :
From Genome Similarity Track
Location :
Scaffold_187:17102- 21889
Sequence
4787 bases(100 bases per row)
CTGGTTCTTCGCCGCGTCACCGATCAGACGCTCCGTGTCCGTGAACGCCACGTACGACGGCGTCGTGCGGTTACCCTGGTCGTTCGCAATGATCTCCACG
CGGTCGTTCTGCCACACGCCGACGCACGAGTACGTCGTGCCGAGGTCAATACCGACCGAGTAGCCAGACACCGTTTGCGCCATCTTAGTCAAGTTGATGT
TGTTGGTTGAGGGTGGAAAGTGGTGGTTGTTGATGCTTTTGTCTTGTCTCCACGTGGGAAATTCGAAAGTGAGGCGAATAAGCTGCGGAAGTGTCGGTCG
GTTTGGGCGACAGAGGGAGGAGAGTTGGGGTCAACAAGATCGAGGGCGAGTGCCACACCAGGTACACACGAACATACCACCCACTACGTTCGAGACAATT
CCGCCCGCGGCAATAAGTGGACGTGAATTGGTCGAAATTCGTCACTCACATCACCCATTTCTCCGCAAGAATGTTTAGCTTCCCGTTTGTAAGGACGTCG
AACGTTCTGGAGCCTCCTCTTTCTTCCGCCAATGATAACGAGTCAATGTGTAGCCAACTCGTAACCTGCGACAGAGTGCGAACGCGGCAACAGAAGTTGC
TGAATGAGGGCGGCTCTATCCGTTTACCTCATAGGAATGTGTCGGGAGGGGGAGCATTGCCGTTCACAATGTTTCGCATCGCTACTTAGACGGTTGCGGT
GTACGTCGTAAGTGCGATACGCGTAGTAGCTACGTCCAGTACAGTCCTGCAGACGAATGTACTTTCTACTCGTTTGTCTTGCAACGCTCGGAGTATCAGT
ACACGAATGAGTCAATCCCTGCTCGAAGACTTATACGAGCTGTCCCGTCACGTTGGTCGGACAGTCCGGTCACGGTAGTGGCGAAGCGACGTTGAAGTCG
GCTCTGAACCGCACCCCTCTGATCACAACCACACGCTGTACAGTCGTAGCATAGTGCAGTACTATCGAATGCAGTAGTAGCACATGCTTTGTTATTGATC
AGAGTACGCAGACACTCGCTCACATTAATTTACAATAGCCCTGGACTGACAACTACGCGAGTTCGTCAGCCTCATACGAACATCACGGCTGGGGACTTCT
GAGTACGGGGTGAGCACGCATTAAGACTGTTGCTGCTGCTGCTGCTGCTGAGCAGCAGGAGGCCGCAGGAAGTTCACGTCGACGTTCAGACTCGGGAGCA
TGGGTCGGCAGCTGCTGTTGCCAATGATACACGACGACGGCAGCGGCGACAGAACGGGTAAAGGCGCTGTAGTCGTCACTGCTACCGCCACGGAGCCACT
CGTAGCACAAGTGGCAAACGCTCGCTGCATGCTCGCAGGATACGACGACTCGGAGTCGGTCCCGTAGACAAAGCCAGGGTGCTCCAAGTGGTAGTGGCTC
CCAACCGAGCCCAACGATACCGTCGACACTGGCGGCGGCCAGTCCACGATCAGGTGTCGAATTGACTGCTCATTGCGTGACTGAAAGCGCACCATCAAGT
TGCGCGCGTGCTTGACCGAGATGTCGGGCAGTTTCCGCAGTGCTGCTGCCTCCACCAACTTCATGAGCTCATCAAACGTCATGAGCACGCCCAGCTCGGC
GCGCGCCACGACGACGCGCATGATGCCAGTCTCATCTCGCTGGTGAAAGTATCCAGTGGTGGCTTTGGACGACTGTCCTTCCTGTGCACGCTTCTTCACG
CGGCGATGGAGAGCTGCAAAGTGCACGCCGTAGACCTTGGCTGCTGCACGCAGACTCATTCCTTGCTGTTCCACCGCCACGATGGCTTTTTCCCACGTCT
CGGGCGGTACCGTGTGACTCAGTTTGTACCCATTTCTCGTGCTGCTGCTTGTGGTGGTAGTAGCTGCAACGTCTCGGACGCTTACAACGCCATCTTCTCT
GTTGGTGTCGTCCCTGCTCACGGTCGAAGAAGGAGCCACACTGGCACTGCTACTATTGCTGCTACTGTCTCCAGTCGTCGCGCCGTTCTCGCTGTCGCCA
CTCCCGCTGCTAGTGTTCGAGCCAAGGTCTTCCCGATCCCACGTCTGTTGGCGCTGCTGCAACGCAGATCCGACGCGATGGTCATCCACGACGAGGGACC
GACGCTCCTGTTGCTGTCGACGAGCGCGCTGCAGCATCTGCACGTCGTGGTCGTCCGTTGCTGCTCGCCTGCTGCTGAGTCGTGCCCCAGCTTCAAGTTC
ACGCACAACGTCGTAGCGACTCGCACACTGGTCGTCAAGTTCGTCCCGCTCGTCGTCACTGCTGGTGGTCGTGACACGCGCGACGTTGCTACTGCAGCTG
CGGCTCCCCACGTTGAGGCGGTGCTCGGGCACTCGGGATGCCACGCTAGCAGCAGGCGATGCAAAGCCGTGTGCGCGCTTGAACGCGAGGATCCAGCGCG
TGGACGGAAAGTCAGGTGGTATGCTCCCAGCGCCGTCATGGCTGGCAACCGCGCGCACGACGAAACGCACGTCGTCCGACGTGATGCGCTGCTCGTGGTG
GAATTGCGCACGCAGCACGTTGAGCACCTCCCGCTCGTCTTGTTCGCTCAGAAACTCGTGCAGCTTCCCGCATGACGCCGCGGACCATGGCGGACGAAGT
TTGGCGCGGCGGTGCTGGGCGTCTACGCCCAAGGAGGCTCGGGGCATGTCGGTCCGTTTCGTGTGTCGGAGCTCAGTCGGACGTCTCGTCCGATTTGGAA
ATGACACGGTCGGCTGGTCTGCGATATGTCGTCTTCGTTCGACGAGCTTCTTTTAGCATGAGATTAGGGGAACGACGAAGTCGGTGGTCAATAGAAGCCT
CTATTGACAAAAAATAGCGATCGGTTGGTGGATTAAGGTTGCTGGAGTAGCTCGTCTCTTCCATGTACGCTTGTGACGCTCATCACTGGACGACGAACAA
GACACTGACAAAGCGTGTTTCGCTGCGTCTAGGGGATCTATGATTGGTACGACGACATTGGCCAATGAGGGATAGTTTTATGCCTGCGCTTGTGACCTTT
GTGACATACGAGTCGTCCAGTCAGTTTACAAGAAGCAGGCGACGAGGAGTAAACAATATGGAAATACATAAGCTGTAGCCAGTGGTTCCTGGCGCACCGC
CGCGTTTCTGTTGACACCAGCGGCGTTGTGGGAGCGCGGAGACGAGCTCACGGAATATCAAGTGCGGATTAGCCATCGATCGACAGAAATAGGATTGAAC
CTCTATCATTCTGGGTGTGAAATGATGTTAGTTGTCCGAAGCTTCGGTGCTGCCACAGCGTGTAGGACACAATTGAACATATTTTGCCCGTGCGCCTAGG
CTTGCTGGCAGAAGCTTCTTTGTCAATGGATCAGTTAACGCTCGGTGTAACCAAATCTGCATGGCTTCCTCGCCAATTGTACCAGCCGAAGGGCGCCGAG
GCTCTCCGCCGTGGTTATCGAATATCTTAGTCGGGATCATCCGGACGAAGTGAAAGCATTCGCTGAAGAAAGAAAAAAAGGTGGCAAAAATGAGTAGTGT
ATGTATTACAAATCTATGGATCCAACGGAATTGTTCAACGTTCGGACAGGAGGACATACTATCACCGGCAGCATCCAGGAATTCTGGGAACTGACTAATG
TGGCAACTCCGCGCTGTAGCAAAGCGGGAGTTACGAAGGATCAAATTGAAGGTACAAGGTGCTTGTCGGCTGTTATGCCAACGTGACCTCGACAGACAAC
ATCGAGAGCCATCACCTCAGGTGACAAGCCCCGTATGACCACGGCCTCGCACGAGAAACCGGTGTTGCTAATCAGGCTTAGGATATACCAGACTTCTTGC
AACCCGTAAAGGTTGAATCGACCAGTCTCTCGCTCTCTTTAGTTGCAGCTTGACCTTTTGTTTGGACTGTCTGCTTTTCAGCTGACTGGACTTTCCATCG
CTGACCGAACCTTCATGTTAAGGTGCTTGAATCCCACGACGACTTAGACTGCAGCTTGTAATTTCAAAGATGGAAAGAACCGAGAAGAAGCGTGCTATGT
ACCGACACCAACGCCCCGAATGGCTGGTATTGCCATCCAGTACGGCGAAAAAAGAGCAGCTGTAGCTCTTTCGACCATCAATGATGGGAATCGCTTCGTG
TCAACCGATCAAGCATATCTTGTGTGGTCTAGAAAATCCAGCGACACCCGACGCTATTCGATCACTCTGAAGCAGCGTGACTGCTTACAGCCATCCAGAC
ACACCAAACCGCACGACGCTCTCAACAATCTCAACGCGAGCCTCGTCCATGCAAGGACGAAAAGGCCCCGAAGAGGTTACTGCACATGATACACGCCAAC
CCCTACCACCGCTTTACGACCTTTTCTCGTTCAAGACACCGCGTCGCTGTGCCCCAGAACGGAACATTGTTCGTGCCGGTAACGTCGCGCATTCTACGGC
TGCTGATTGCCAACCTTGGAGTGATGGGCACCAAATTTTGAATTTTTACGATGTCCTCCTGATACTCATCCAACTGTAACTGTCTTGCGCAAAAAGACAC
CACCATCTGCTTCTGGTTGAGGTCGTCACAGCCACAACAATCAGACATATTTAGATAGGAGCCTACCACTCGGCATTCCGTAGCAAGGGAATGTTGACGA
AGAACAGCATTATAACGCAGTCTTCCATGAAACACGATTTTGGTCTGAGCTCACGTACAGAACACGCACGGCTGGTCACATCGCTTTCATCGGAAAGGCA
GCAACTTCGAGGTAACGCAGGCTTGCCACCGCAGCACTTCGCAATCTCTAAACCTTCCACACAAGTGATGTCTATAAGGCTAGTGGA