Description :
From Genome Similarity Track
Location :
scaffold_1328:1710- 3211
Transcript NameFunction/comments
Pl_100846hypothetical protein PHYSODRAFT_551426

Sequence
1501 bases(100 bases per row)
TGACTGGGGAGGTGAAACTTTGGTTATGGGGTTAATACGTGTGTTCTACTACTGCTATCTGCACTTAGTTGGACGTGGTGGTGTTCCGCACGTAGTACGG
GTCCGACTGGTACTCCTCCGAGCAGTACGGGAACGTCACACCGTCCGAGTCTGGGTTGAACAGGTTCTTACCGGCGTAGTACATGACGTACACGCCCAGA
ACGGAGCACACAACGATGATCACCATGGATCCGACACGCTCGTACATCGGGAGTTTGTTCCAGAAGATCTTCAGGTAGAACATAAGTGGCAGCACGAGAC
TTCCAGCGGTGACAGCAGTAGCGCCCGTGAAGTCAACGAGATCGAGGAAGTGGTCACGTAGAAATATTGATGCCACCACGAGTAGTGCGAGGATGCACAA
ACGAAGAAGAATGTAGCGAAGCATATTGAGTGTGCCACGGTATTCGGCGAATTCATCTTCATACTTGACTGTCACGTGTAGATTGTCTGATGCAGAGTTG
TAATTGCACTCCACTTCGGGAGTCATCTGTGCAGACGACAGCTTGTCACGCAACTCAACACCTTGCTCTGCATCCACAACGGGTTGGTCCTTGTGCATTC
CAAGAAGAAATCGTTCCGCCATGAAGAACGCAGGCATGGTGATGGTAGAGAAGGCGATCACAATGTGAACGTGCATGAAGAGGTAGGCCATGATCACAGC
ACCGCGGTTCGGAATGAAACCCAAAGCCGAAGTCGAGTACGGGTCCGAAGTGTTCACAGCTGAGAAGAGGAGGTTACCGGAGAGTTGACAACCACCAGCG
GCGTAGCCGGCAATGGCGACGGCAAGGAAGAAAACAGTGCCCAAACCCATACTAACCAGGATGACACGAGTCATACGTTCTGGTTGGGAGTGTTGACGCT
GTAGATCAGGGATCACCACGGCAGCACCGTACGCTAGTGACAGATTACCGAAAGCAGTCAACACTTGGTGGAGTGAAACATCGGGAGTTGGGATCGAAGG
GTGACCTCGCATCTCCCACTCAAGAATCGACACACCAACGACATCGGCAATCAGCGTTCCTAAGCAACCAACAAGAGCCACCGACGACGCCTCCTTTAGA
GTCGGGATCATGCATACTGGAATGACCGTGACTGCCATGAAGATCATCCAGAAGATCTGACTGAACGAGTCTGGAAACAGCACGTCTAGTAACGTACTAC
CGAGCACCAGGAAGGCACAAGGCAATAGCAGACACACGAGCAATTGTGATATCATGACGGCGTATCGTCCTGGGGTTCCGAAAACCCAAGCACCGACATC
CGTGAAAGTCTTGACCGATCGTGGTGCCGAGAGAATGACCTTGGACAGAGCGATGGTGGCGTAGATATTCACGAACGCCATAAGCAGCAATGCGATAGTG
GCGTATACCGGGCCGGCACGGGCGTAATTGGACGGCATGGACAATGATCCAATGCCGCAGAAGCAGCAGAAGATGTTGAAGCTGATCTTGGCATCTTCGA
G