Description :
From Genome Similarity Track
Location :
Scaffold_2970:171- 2705
Sequence
2534 bases(100 bases per row)
GTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGC
CCTGGATCGACTGGCGAGGCAAGGCAATTGGTGCCAGCCGCCCTGCGCAGCCCGACAGAGCATTGGTGAGTCATGTTCCCCACCTCTGTCAGGACCCGGG
GCGCCCGCGAGGGCTGCCAGGGTACCGAAGCACCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCAAGGATGTTTTGATGGTGGCCGCGCC
CAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTC
AGAGTGGGTAACAGAGTTTCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGG
TCGCCCAGACCTTAACTAAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTTCCTCGGATGTCGTAGCGAC
GACATCCCTAGACGTGGGCAGCAACGCTCCCCGTCACAGACGCCGTCGACAAAGACGCCGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGATC
GACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTTAGCC
GTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCGGAGTCTTTCCTGACCAACCTCAAGG
CTGGAGAAATTGCTGCGATGGTACTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACGCCTCCTCTGTCTTGGACGAGGACGTCCTGGAAGACCTGAA
CAAGCAGCGTCAGACGCGCTTGGGTTCTGAAATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAGCAC
CCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGTTCTCCCGCGCGA
ACAGTGCGACGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTTCTGCGTTCG
TAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTTG
AACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTATCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTAA
GCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCC
TTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGT
CGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCA
ACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCAATAGCAGCATGGCCGACGCCCCGATCTCAGAAGGATCTTCGAAAGTGGTTGGATTTGGCCAA
CTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAG
GATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATT
ACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCC
TGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGC
GTCCTTGAGGACGGCGACTAACTCGCCTCACCCCTCCCAACGGGTGGCGAGGTGGATGACGTTAAGCAAGAGCTATAAGATCAGAGGAAAGAAAAACACC
GACCAAGCTCCACAGAGGTTGGCAGACGCCCTCACAGAGCTGTCCTTCTAATGAATGGGTCCACTGCACGATGAGAAAACTCGATCACACTGAAGGCGAC
ACTAGACATACAGGAGAATAATAAACCACAGCAC