Description :
From Genome Similarity Track
Location :
Scaffold_3492:171- 2068
Sequence
1897 bases(100 bases per row)
CTCAGCGCGATAGAAGGCCCACCTTGAGGGCACCTTAAAACAGGTCTTTCAAAGTGATGCGCGAGAACAAGTTTGTACGCGAAACCCTGAAAGAAGTGTA
TCTTTCTGCGCGCCGGAGATTCCGGTGCTGGGCTGCTTCGTGGGCAAAGGACGGCGTTCGCGCCGACCCCGGAGAAGGTGTCCTCTATCTGCGCATGGCC
GACACCAAAGAACCCCACTGAGTTGCGTCAGTGGTTTGGGACTAGCAAATTATCTCCACAAGTACACGAAGAATTACGCCGGACTGATCCAGCCCCCTCT
CATCACTCCTGAAGAAAGATGCCACATGGGTCTGGTCACACGCGCACCAAGCCGCCTTCGACTCAGTGAAGAAGAGCCTTGCTGAGGCGCCGATCCTAAC
TCTTCCCCATGACTCGAAACCATATCACGTCGTTTGCGACGCGAGCGACTTTGCCATCGGCTGTGCGCTGATGCAATTTGACGACGAAGGACGTGAACGG
GTCGTCAGCTATCAGTCTCGACAGATGAAGCCAGCGGAGCGCAACTATCCTGTCCACGACAAGGAGCTTCTCGCGATGCGCTACGCTCTGATCAAATTCA
GAGTGTACTTACTCGGCGAGCAAACCTTCGCAGTGTATACCGATCACGCATCGCTGAAGACAGCGATGAAGAAGCCTTCACCTTTCCCCAGCCGATTGCT
CGCTGGGTGTACGTCTTCTCGAAGTATAATTTCGTGGTACAACTACCAAACCGGCCAGGAACAACATCCTTGGCGGATGCTCTGTCTTCGTCGTCCAGGA
TTTACGACCCCACGCCGATTCGCTGGGTCGAACACCGGCTGCATGATGGAGGACGACGGAGGACAACTGGTGCTATGGTGCTTTGGCGGTCGGGGATTGG
ATCTTGACGAGCGTGTCTTTCAGAAACCCTACTCCGCGACGAAATTCGGACTGCGTATGAATTCGATCCGGGTCTATTCCAAGTATTCTGGAACATCTCC
GCTCGCCCAGTGAAAAGACACTGAGTGCTTTGTCGCGCTCCACACGCCATCAGATCGATAGGTATCGGATTGAAGACGGGCTGTTAACGTACAGCATCGA
TCGCTTCGATGCTTCGCGTGTAGTGGTCCCCAACGACCCTGACTTGCGCTCGCGGATCATCCACGAGCTCCACCATATCCCCCTTGGCGCTCACTTGGGC
CGTGAGAAGACATTCGCCGCAGTGTCGCGCGACATTTACTGGCCCCACATGTATAAGTGGGTGCGCAAGTGAGTGAGGACCTGCGAGATCTGCCAACGCG
TGAAACCGTCCGCGTCATCGCAGGCTCCCCTGCGTCCCTTACCAGTGTCCACCGAAGCATGGCGCTCGGTGTCGATGGACTTCGTCTTTGGCCTCCCACC
CGACTCCGCCGGGCGCTCCGGTGTCCTGGTATTCGTCGACAGGTTCAGCAAGATGGTTCACCTCATCCCGGTCCCGGATACGATTACCGCGGCCGATACC
GCGGTGCACTTCGTGGATGCAGTCTTCCGTCATCATGGCATGCCCGAGCCTATCGTTTCGGACCGCGATCCGCGGTTCACGTCTGCTTTCTGGACGAAGC
TCTTCGAGCTATCAGGGACAAAGTTGCTGATGTCGACGGCTGCTCATCCGGAGACGGATGGCCAAACCGAGCGAGTTAATCGCGTCCTTGAGGACGTACT
TCGCAGCCAGGCGACGTCGTTCACGAGCTGGAGCTCGTTCCTTCCGCTTGCTGAGCTCGCGCTGAACAACGCGGTTCACGCGTCGACTGGCCTGACTCCT
TTCTTCGTCAACAACGCTCGGCACCCTCGCGTTCCAGCTCTCCTCACCGTGGGCCGTCCCACGGCGCCGTGTGGCTCCACTCTGGGTGGGGGTGAAA