Description :
From Genome Similarity Track
Location :
Scaffold_459:171- 2010
Sequence
1839 bases(100 bases per row)
AGCCACACCTCTCCGGGTCATCGCCGGGAAACGGCATTTCCCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTGAGCTCTGTTGTACCTCGAGGCGGT
AGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAAAAGAGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCT
TTGCAAAGCCATAAAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGA
AGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCA
TAGCGTGGAACGTTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGACATGGCATGGCTGGAACGTCATGAGCCATGGATCGACTGGAAG
TCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACG
AGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCC
GCTGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATCCACTGAGTGGTATGAATCTGGTCGAT
GACCTACCGCTGCGTGACCTGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGT
GTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCATCTTCGAGGAGTGAAGGTGCTGCTGCACTCGGTGGTGGTGACGG
AGATGTCGCCACACCGCTCTCATCCGGCCGGGATCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTG
TCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAAAAGCTGTATACACTCGTGAACGGAGCGACGGGGGAGGTAGAAGACGATATCAGCCTTG
ACGCTCTGCCCGCTGCAGATGCTCTGCTAGAGATGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTGAAGGCAGGCGAGCTAGCCGAGGTGGTCCT
GCTGGGATCTGAGGAGCAGTTATATTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCACAAAGTGGATCGGCGATC
CTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCGACGGGCCTGCCTCCAGATCGAGGCGTGT
GTCATGAGATTAACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCAATGACGCATTTTCCCGTGC
GAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCAACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCT
TTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGCTGTACAGCGCGC
TCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGTG