Description :
From Genome Similarity Track
Location :
Scaffold_19:170979- 172880
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007675Similar to NOL9: Nucleolar protein 9 (Homo sapiens)

Sequence
1901 bases(100 bases per row)
CGTCGCGCTTGCGCTTGATGTTGTTTCGACTCTGCATCACGGCCGCGCCTGTGCCCTCGGACGAAAGCACGTCCGTGACGACGTACGGCTCGTTGGCGGA
ACTGCTACCCAGGACAAGCGCTTCGAGCGGAAAGTTGCCGCGCACGAGCAAATTCACACGTGCGAGCATGTTGATTGGCAACGGACTCAGCACGTACAGC
ACGCGCGCCTCGACGTCCACGGCGCGGATCAAACCCACGCCCAGGCACGGCGCATGCGCAGGCTTCAAAAGTATCCGTGGCGGCCCCGTTCGACTGCTAC
TCTCATGAAGGGGCTCTCGCGCAACATTGATACAGAGCCCAACGATGCTGTTGTTGAGCGAAAACAGCGACTGGCTCGGCGCGACCGACGAGCCCGCAAA
GCTCACGTCGACCGCATCAAACGACACGACGTAGGGCGTTAACCGAGCAAACGCGCGGCAGATCTGGTCGTCGATGCGGTTCTTCTCTGAGATTGTGTGC
AGATTCTGCAATTGTGCACGTGGGAGCTGCGTCGTGGTGCAGAAGCTCTGGGCCAAGAAGTAGTGATGCCATCGATACAACCGCATGTCTTTCGACGACC
GTGACGGCTGCGTGGCGCCAAACGAATCCCACGGCTCGACGCCATGGACCTTCCAAGATGGCGAAGATGGCACTGTAAACTGTTTGTTCTTGGTGGTCGC
GAGCAGCTGCACGACGTGGTCCGGGTTGGCGTCCTGGATCACGGCGCACAGCAGATCGTGACCCATGCTCTTGATCCACCCGTCCGTATTAATCACGAGC
GGCACGTCCGCCTGCTTGGGCTTTGAGTCAGTACTGCCCCACTTGGCTTCGTACACGCGCAGCAGGCTTTTCACAGCCTGCATGTAGTACAGCGGATCGT
TGCCTGGGTTCGTCGCACCGCAAAAGAACGCGCGCAGCGGCGACTTCATGTGCGTGAACCCTGGGCCGAGCAGCGGTGACACAAGCGCATGCAGCGACAC
GAGTCCCGGCGGCGTGAGCTCCGACTGACCCAAGTCCGTGTCCAGGAACGCGACCATGCCGTAATGCGACAGCAAACGGTTGACCAGGTACCGACAGAAC
GTGGACTTGCCCACGCCCTTTGCGCCACACACAACGATACGCTGCTGCCTCTTTTCGTTGTTGTTGGCCAACAAGCTGCTCTCGATCGCATCGGCCGTGT
CTTTCCACTGTGGCGTGATCTGGATCGTCCGGAACGCGTCTGCAACGAACAGCTCCGAGAGCACGCGTACCGACGACTTCCAGTCGTGGTACTGCTGCAG
ATCACTCCCAGGCACCTTCGGCGCCTCTTCTTTCTCCACACCCGCTGCAGCAGTCTGTAGCTCAGCGTACTCTTCCTTTGCAACGATAATCTTGAACCCA
GGCAGCACGACCTGCGCACTGCTGTCTTTCTCCAAGAACGTCGCATTGGCGCTGGAGCTCTCGTAATAGCACGTCGCATTACCAAACGACACGGGAACGG
AGCGGAAGACCAACACGATCGGGAACTCCTCCGCAATTTCCTTAGCGAGTGCGTCGGCAGCGTGCTCTTCGTCCATCTCTAGTGCCGCCGCGGCCGCAGG
CTCGATGAGCGTCAAGAGACTGCGACTCGCGTCGCTGTACGGCGCCTGGTACGCGGCATCAAGCAGCTGCTTCGTGGCCTCGGAGCGCGTGTTGGCGTTC
GTGCGGCCTTCAATGACCACGAGACTGTTCCACTTGGGCGCGTACAGCGAGTAGTACGAGCCCAGCGCCGGCTGGAAGCCCAGTAGCTCGACGTGGCCCT
GGAACACGCGCATGAGTGCCATGCCAGCGCAGTTGATCGCCGCGTCCACGCGCATGCCCAGCACCACGGCGTTGCCTGAGCGCACGCATGCGGCACGGTA
C