Description :
From Genome Similarity Track
Location :
Scaffold_1:170974- 175955
Sequence
4981 bases(100 bases per row)
GGAGTCGATGAAGACTTTCTGTTGAGATGGTTCGTGGAACTAGACGATGCCATAAGGGCTATTCATATCATCGATGAGGAAATGCAGATTGCATTTGCTC
AATAGAACTTGGCAGGGCGTGCAAAGACGTGGGCCTTGGGCCTCAAGTTACACGATCCATATGTCTCTGAATCGTTGGAAGTCTTCAAGTCCCTGTTTAG
GCAAACATTTGAGCCGCCGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTGAGAATCAAGCAAGGTAAACGTGACGTACACTCGTACATTCAGTACATA
CGTCACCTTACCAGTTGCATAACAGTCGACCCACTGAACCGACAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGTTAAAACCTACC
TGTTCCGGTTGGAGTTCAACACCCTGGAAGAGGCGATAAGGATTGCGGGACTGGAAGACTTCAGCGTGAAACAGGCTCACGTGAATTCAAATTCTTATCG
TCCGTCGAGACGACAGGAAAAGAAAGACCCAGAACCAATGGACCTCTGTCACGCGGAAAGCGAGAGCTCTCATGTTAACATCTACAAGAAATTGCAAAAA
TGCAATATGTGTCAGAAGCCAGGGTATTATGCATAAGAATGTAGTGCCCCGAACGCGGTACCACGTACCGCAGGAAACAATAACTTCCAAGCGGCCAAGC
GGGGTCCAAGGCGTGGGTCCGACGTTGTTGCGAAGACGCAACAACGTGCCGGACACGCCAAAAATGGTCGGGGTCAGTAGGTGCGGAGCACCCTACTGAT
CCAGCTACGTCAAGTGCGTTTGCAGACCTCTTGACGAAAGTTGCTCCCAACACTCAATTATTGTGTGTTGCTGCTTCTGATAATGAGGTTTCCCTGATTA
CCTTGAAACCCGAAGTGACACAAAGCATGTTGCTTCGAGCCCTAGTCGATTGTGGGGCGTCGAACAACTTTGTACGAAGCTAATCGCTTGACAACAGCGA
GCTCAAATATATCGAGTGCGAGATCCTTCCAACGAGGATGACGGTGCGCCTCGCATGAGGCGCATCCGTGACAGTGATGAAACGTGTAGTGGGTATTACC
TATACACTAAAGGGAGTCCAATATAATGATGACTTCATCATATTGGACTTGGATGACAAATTTGATGTTATTCTTGGACTGCCGTGGCTCAGAAGGTACG
AGCCACAAGTCAGATGACATCGACGAACAGTCGATATGACTGTCACTTTTTCACCAGATGATCATCTGATGAATGCAATGGAGAGCCCACTAACATGTGG
GTGTACTACGAGAGAGTGCGATGGCCTCGCGTGTGGTTCGGTCGTTAGTACGACTGCAAATGACCATGACGTGGCTGATCGCCACACCATGGAGCCAGAT
TCCGGCGACTGCATTGAGATGCAGGTCGCGCCGAAGGCCCACCACCCGAATAAGTTGAGTGGACTGGGGCATGGGTGTCCTCCAAACGGACAACACCCAA
GTGAAAATGAACCGATTGCCAATGATTGGCAATACGATGATCTTAATGCGATAGGAGAATCGCACGTGGAAGACCTGGCCGCGTTAGCGCAACCACCGCC
AGAAGATATCGAGGGAGCAATCCCACTCGTGTCATGTGATTATTTAGCCCAAGAGTCTAGTGAGGGAATAAGTCCCTACCCAACTGTGGAAATAAGTTCC
CAGGAGATAACAGAGACATCAAATGTCCTGGTCAATGACGGATCAAGCATAGGCACTTACCAACTTGATCTGACCGCGCCTCCGAAGACAACTTCGGAGA
TCACTCAATTGCTCACGCTCGAGCAGAAGAGGTTCTTGCACGATCTGCGTAGCGGCAAAGTCAAGCAGATTTGCATACTCGTCGCGGAAGTCAAGTACGT
AACCGATATTCGGTCGGCAATGGTATTCGATGAGAACGAAAGGGTTCTCAGCAGCTCATCAATGGACGAGAGTGTCCTTGATGATAAGACTCGGATTGAG
CGATATACATCCCAATCATGGGAATTGCTCAAGACAAATCCTCTCTACGATGATTTGACGGAATTCAGGGATGTGTTCCCAGAAACAGTGCCGTGCGAGC
TACCCAAGGATAAGGGTACTCGTCATGATCTCGACCTGAAAGCAGGTTTAAATTACTGTGTCATGAAGCAATGACCATTGCCTCGTGAACAAGTACTAGC
GATTGACAGATTCTTTGCCGATCGCTTGGCAGCAGGCCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTGTCCGAAAGGCCACAGGA
GGATGGAGGATAGTGCATGCCTTCAACAACTTGAATGCTGCAACTGTGCCGGCTCAAAAGCCGATACTAAGAAAGGATGTCATTATAGATGGTATGGCAA
GGAGTACCATCTTTTCATCGATGAATCTGATGAACGGGTTCTATCAGATCCTTATGCGCGAAAAGGACATTCCGTACACAATATTGAGCACCCCGAGCGG
TTTGCTCTGGGAGTAGATAGTTATGCTACAGGGATTAAGTAATGCCCCTGCTAATTTCAACAGATGCGTTACAAATCTGTTGAGATCTGTGCAAGAATTC
GCACCTAGTTATTTTGATGACGTGTTCGTCCATATCCGGGCTATGGATAGACAGACGGATGTGGAAGTACACCGACTCCACATCCGAAAGGTTCTTACAC
TGATGCATGCGCATAAGTTATACGCCAACCTTAAGAAGTGTATATTTACTGCTAGCGAAATACCACTTCTTGGATGCATCGTGGACAAGCACGGTGCCAA
GCCCGATCCTGGAGAAGGTCAAGGCGATCACTGACTGGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGTTCCTTGGTCTAGCGGATTATTTGCACAA
ATACTCGCACAATTACGCCGAGATGAGTGTCCGTCTCTCTCGATTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGTCAGCGCTCATTCGAA
GGTATCAATCAAAGCTTGATACGCTCGCCAGTTTTGGCGATTGCAGACCAAGACAGACCATTTCATGTAGTCTGCGATGCAGGTCATTTTGCCATCGGAT
GTGAACTAATGCAGTATGACACAGACGGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCTGAATCCGGCTGAGCGCAACTACCCGGTCCATGACAA
GGAACTCCTTGCCATGAAGTATGCTTTGGCGAAGTTCAGGATCTACCTGCTAGGCGATAGACCCTTCATCGTTTACACGGACCATGCATCCTTACGCACG
GCCGTTAACAGTCCACACCTCTTGCAACGAATGGCGAGGTGGCTGTCGTTCTTCGCGGAGTATAACTTCTCCGTGGAATATAAACCAGGACGACTGAATG
TCGTCGCTGATGCTCTGTCGCGCCAGCCCGATTTCGAACCGGCTGCGTAACCCTACACTGGCCCCACCACTGTAGCGGTGTTGATGTCGAGTGTCGCGTC
GTCAACCTTATTCGAAGACATATGCAAGGCGTACGATCCGGCGATGGTGCGCTTGATGGATCGTCTCTCGCAACCATCCCATCAATCCCTTAAAGGGTTG
CCTCAAGTATATCGATCCTCCACGGATAGATATACAGTCCACAATGGCTTACTGAATTATTCAGCCGTTGCTGGCGACACGCCTCGTGTCGTTGTACCGG
ACCATGGTGACCTGCGACTGCGCATCATTTATGAATATCACGATGCACCTACTGGTGGACATAGTGGTCGAGAGAAGACATATCTCACAGTTAGTCGCGA
CTTTTACTGCCCCGCCAGTATCAGTTCGGGCGTAAGTACGTCCGCGCATGCGAAGTATGTCAACGAGTGAAGTCTGGTCCTTCACTTCGTGCGCCGTTGC
AACCCTTGCCCATTCCGGCAGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTTTGGGTTCCCCGCAGATCTAGACAAGAATACCGGTATTCTTGTGTT
CGTTGATAGATTCAGTAAAATGGTACACCTGGTCGCTGTACCTGAATCCATCAATGCATCGGCATGTGCTCGAGTTTTTATTGATATGATCTTTCGTCTT
CACGGGTTATCTCGTGAATTCGTCTTCGACCGAGGCCCACGGTTCACTGCTGGATTCTGGCGATCCGTGTTCAAAACACTCGGAACTCGCCTTCAGATGT
CGATCTCCGACCACCCTGAAACATATGGTCAGACAGAACGTGCCAACCGCGTTCTTGAGGAATACCTTCGGGGTTACGTTCATTCGTTGACTAATTGGAG
AGAATTCTTGCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGTGTACACCGTTCTTCGTGAATGGCTTGCGCAACCCACGCCTA
CCCACCCTTTTAGAGTGTAACTTTAGTTGGGGGGGAGGGACTCATTCAAGCGAACTCCAACTCGGCTCTCACTCATCACGTACTGACCACGAGGTCACTA
CGTATGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGGAAAGTAAGAGAGAGGGTGCTATTACTACCCAGGTCACTGATCTTACCGCAGTGCG
CTCCAAACGCACTATAGCTAAAGACAGCGAGTCAGCAGATGAATTCATACTGGCTCGCAAAACGGTTGTCCGTTTCGTGCAAGATTCCATTGCAGAAGCA
GTGGACCGACAAAAGAAAAACGCAGACACAAATGGAAGGGCAAATGTTTTTTCATTCACTGAAGGTGACCTAGTCCTACTATCTACGGTAAACTTACGTC
AACACATAGTGACTAACGTGGGTAGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCACCGCTTAGGCAACGCATACACGATTGAACT
GCCACGTAAGGTACGCATGCATCCTACGTTCTACGTCGGTCGCCTTAGGTCTTATCACCAGTACGGGACTTCTTCCGGTGA