Description :
From Genome Similarity Track
Location :
Scaffold_586:17096- 19275
Transcript NameFunction/comments
Phypl_g9609hypothetical protein

Sequence
2179 bases(100 bases per row)
GAGTCGCTCCTGAAACCTTAATTCCACAAGTCGGAGCCAAAAGATCGTAACACTAGTTTATATACAACCCGGAAGTTATGGATTGACAATAATAAACCTG
AAGCACACGAAAACGCGCTTTGATACAAGTTGGACACGCCAAATACGGATTTTCACTGCATCTGAGTCAAATGCTGTGTCTCTCGCCCTGAGCTACAACA
CCCACGAGCTACGCTACATCTGCGTTAAATCGTTGTTGTCCTCACTGTCGGCTCGGACACCTAGCGATATTCGCTGAGGAAGCCGCCGTCACTAGCGGTA
TCGCTCCAGAGAGACTcgtcgcttcttctgcttctcgctACCGATTGTCACTAGCCGGTTCTGGCACTGACGGTATTTCTCGCCGTTGGTCGTGCGAAGC
GTGTAAAACCCGACGTGGAATTTCATCAGCGCTGGACACGCCTGGAAGATGTCGTTGCAGAGATGCCcccccccaccaccaccggTACTTGTTGGCACAA
ATGCGGCAAAGCCCGCACATCCACCCAAACCAGTTGTCAGCAATTATTATATCGCTAGCAATGTCGGCATTTTGTTGaacggtggcagcagcagatatGT
GGGTACCCTTTGTCGGATGGATACAGCGTACATGCTGCTCGTTACCCGGGTACGTGTTGTCCGCCAGGACCGCCCACTCATCATCGAGATATTCCCTGTA
GAGGAGATCAGTGTTCTGCAGCGTGCGGTTGTTACTCGACTCTCGGCGCGTGGTGTGGTGAAAGGCCTCGTTGCACCTGAACATCGTCATGTCGGCGGTG
TTGCCGCGAGAGCGTTCCGTGAAATTAATAACAAAGCCACGAGAATTTGCCGACACTTCGACTTTGGCGCCATACATCTTGTGCTTGGTGCTGTAGTAGG
GAAGCGCTTCTGACATGTTTCCGGCGGGTCTATTAAGCTGCTGAAACGTGACGTCCGTCTCGGCAATGCGCACGGATGATGCACGAACGTTCAGCCAGAC
GTGAGCCGCGTGCCCATGTTCTCCGCCTAGGCCTTCTTTCTAACCCAGTCATCGTAGAGACGCGGGGCAACAGCTCGGATGAAGATGATAATTGTCTTGA
TGAAGGTGGAGGTTGGGCGTACACCAAGCAAGCACAAAGGTAACCAAGACCAAGAGATCCTGGATTTTTGCGTGTTGAAGTGTGTAACCTGTTAGATCCA
CCGGAGACACATCTTCCGTGTAGCATACTGAATGGGACAATGTAGCTTTGCTCTAGAATGCAGCTGGCGTCGGCGAATTGATCAAAGCCCGATCAGGAGG
CAGAGACTTGATCTGAGGCCAGAGTTGTCTtggagtgtgtgtgtgtctaGCGTTGCTTGCCACTTTCGATAGCGGGATTGAGAATCGATCACGAAGTGAT
AACTGGTCGATGGAGATGCGCACATGAAGCGTAGTTCACTAGCGTGGGGGACTATACAAGTACACTCTTTGCGTGCTTGAGCACGACGCATCCTCTATCA
GGCCCCTAAATTCCTTTTCCGATGTACCATTTAGCTGCATCGTGGTACGATGTGCGATGGGAATGGTGTATTGGATTCTGCAGAAATCTTGCCGCCGGCG
TTTTTACTGGTCGTGTTTAAACATGCCGCAGTACGACTCTCTCACGCAAAGGGACGCAATAAATGGCTCAGCACCTGCTTAGCTCTGCGCAGCCTGTCGT
atgtcgtcgtcatcttaCGTCCATTTAGAAAAACGGCAAGTCGAACAACACAAGTACAGCAGCGGAGAGAAGATAATGATTGCTAAACTCTACAGTTGTC
TCGCTGTCCAGAAAGCGCTAGGCCTTTTCGACGGAGGGCGCACGAGAGACCTTGTCGTCGAGTGGCTCGGATGTGCCGCTGAGACATTTGTGTGTGTTGT
TGCCCTTTACAACGCGTGCCAGGTCATCGACTTCAACGTACCAATTGCTGCAATTGATCTACAACTGCTTGTTTCCAGTGCCTCTATCAAGTAATTTATT
TCGTGTTGACTTCATATTTCCCGAACAATAGACGAAGGACTTCCTCGTATGAACTAGATGCAATTTCCTCTGATACCCGCGAGATTGAGGTGGGACGGAA
CCTTGCGGGTTAGCCGCTAAAAGCCCAGTCAGGTATTGCACACGAGTAAATTCGTTCGCCTTTCCCACAGTACCACAGT