Description :
From Genome Similarity Track
Location :
Scaffold_186:17096- 18522
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_186-snap-gene-0.21P21-activated protein kinase-interacting protein

Sequence
1426 bases(100 bases per row)
AATCACCCCAGCTGTCTGCAATTCCACCTGGCCAATCGCAGTGGCTACAGTGCGAGCGTACGCTGCGATCTTCCAAGCACTTGTGCTTTCTCTGCGATGC
CCAGCCGCCCACGTCCCAAGCGGCGTCGCTACGTCTCATGAGCGCATATTTTCAGCGAAACATTCCTCGAAAATGTAGCCATGTTACAATATGCTCTTCC
TCCTTTTAGTGACAGTGGGTAGTTGTCGTACTTTATCAAGTAAcTAGAGTACTGCCGTCGTTACTGGTTGACCACCAAgTCACCAACAGACACGAACAGG
GAGAAAcGATGGCGAGCATGATCCGCATCGTCGCGGGCACGTATGAAGGCCTGCTGTACGGATGGGAGCTtCCCACGGCGGCTGCCAAGGGCAAGAAGAT
GAAGCTCACaTTCGGCTACTCGGCGCACTCCGAATGCATCAAGAGCGTGTCGCTGATGACGGCGAAGCAGGGCAAGACGTTGATCTCGGGTGGCAATGAT
GAGACCATCAAGTACGGCcATTTGCTTGGGTTTCTGGTCGAATGGTGGGTTGGTATTGACGGGAGTTGGTGGATTTTGTGTGTGTGCAGGATCTATAACG
TGAACAAGCGCGTGGAAGTGGGTACGCTCATGGAGCACAAGGGTGCtGTGACGTGTCTCGAGTTCTTCGGACAGAGCCACATGCTGAGTGGCAGTGCCGA
CAACTCGATTTGCATCTGGCGCACGGCTGACTGGAACTGCTTACACATCCTTGGTGGTCACAAGGGTGAAGTCACGTCGATGGCTGTGCACCCGAGTGGC
AAGCTGGCGTTCTCTGTGGCCCGTGACCGCACGCTGCGCATGTGGAACCTTGTCAAGGGTCGTATTGCATACATTCGTCGTCTGGAGAAGGAGGCATCGC
TGGTCAAGATGTCACAGACGGGCTCACGTTACGCGCTGTGTTTTGGCACGGAGCTCTCGGTCTTCAGCAGTGCGAACGCCGAAGTCGTTGGTACATTGGA
CCATGGCGATAAGATTCACGCGGCGGCGTTTGCAACCGACGAGTACATCGTGTGTGGTGGCGAAGACAAGTATatttATGTGTGGAAGACCAACGGAACG
TACGTagTGAATGCTGTTCGCCATtCTTTTGCAAGCGAATACTCATGCTAACTTGCCTTGAACGCTTAACGCAGTCTCATGGCTAAGGTCACCAACGAAG
AAATCACGTCGCGTATTCGCTGCATCGAAGTCGTCTACCCACATGGCGAGGACGATCTTCCGTGGATCGTTGTCGCAACCTCGAACGGCAGGGTGATGGT
GTGGGATCTCGCCGAGTTCTcTCTGGACGCCTTGGCCCCAGAGGAGGCGAACACTGACGTCAAGCCATTGACCTCGGCGATGATTCTCAGCAAGCCGCGC
GTAACCTGTCTGTCGGCTTGTGTTGT