Description :
From Genome Similarity Track
Location :
Scaffold_159:17095- 18463
Sequence
1368 bases(100 bases per row)
TGAGGCGTGGTGAGGTAAGAAGATGAGTGGAGGAGGGTCCTACATTTCGTATTGCACTGTGATTGGGTATTTTATTTTTGATAAATTTTAGGGGCCATCG
GCACTCTCAAAATAATGATTTGTTTATCTAGGGGGTATCCACGTAGTAATCAAGGGGTGTCTACCTAGTTAGTCCCTTTTTATCTTCTCATTACCTGGGT
CATTTTTTAGTTTCTAAATATCTGGGGCATTTTCCCCAGAACTGAAATAGAACCAGTGGTTGTAATCGTCAAACTCGACGAGCACAACCTTGCTGCGTAG
TTATCTTATAACCTGATCTAGCGATAAACCTCACACAAAAATAAATAACTAGCATAATGAAACAATTCTTATTAATTCCACAAACAAAAAGAACAAGCTC
GATGCACGCATCGAGAGCTGTGAATCATCACGAACCTACATTTTTAACTCGGTTTGATGTAGACAAATTATTTATCTGAATTGGTTTCTATCAAATCTAC
TAACCCGCTTTTCTAATTGAGCATAATACATTTATGAGCTATATCTTTTTATAAATGTATCTACTTGGAGTTTCTAGGCGAGTCACTTGTTCTTAAGGAT
CCCCAATTTGCAACCCATACTTTAAATAAATCTATTCCGTACTTAAAAACGGGTTGCGATTTTACGGACATGTATCAGGCTTTACGATAAATAATAACGA
TAGCCAATATATAGACCACTCCCTTCTTTTCTAGTAATACCGCAGAAAAATTGCACCCGCTGATTGAGAGCAGTACTTAAAAATTCTCTACGTTCATAAT
ATTTTTGATTTCGCTCATTGTACATTTAACCTTACCGGCGATTGGCCTCCAGCAATACATTTGATATGTATCCAAAGAGGAGGACTTCACAAATGACATC
TTTAACTGCTCGAACGATGAGGGCGCTATCTCTGCCACGATAGAAAGATTTTGTTAAGATGCAGATCTGTTTTGACCCTTCGAACATTAATCGCAGTCGC
GATACAGACGTCGCGATGGTTGAAAAAGCTGATAACAAATTGAAGACCTACGCGATAGCGAGTTTTGGACCGATCTTATATACACCCATTTTATTCAAAA
TTCATGTCCTTTATCAAACTAATATTCGCTCCAGTTTTGCCAAATAATTTGTTATACCATGTAACTCATAATCAGTCCCTACATTAACCAACAAAAGGCT
CCATATTGTATTCCCTACCTTATTTCTATCGAAGTTTGCATTTACCCTAAAGGGGCACTCTCAACGGGGCCGTGTGGGATGAATCTCGTGGTTGAAGTCA
TCATAGAAACGAAGGAATATATCTTAAGTTTAAAACGCCCGTCCATGTCATATCGAAAGGAGTGGTCG