Description :
From Genome Similarity Track
Location :
contig_54:170924- 194127
Transcript NameFunction/comments
g9155.t1hypothetical protein

Sequence
23203 bases(100 bases per row)
CAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTCTCCAGATTAGTTCTCGTCAGC
GACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCATAAAGTAGCCCGCCACATGATAAATTTGAGGCAGGCTCCCACGTGGGC
TCATCATACCCAATCCACTTCACTTGAACTCTCGGACAGCGCGGCTAGTGCCCGTCGACAGCGGGGATCGGTCATCGAGGATGGCTTCTACCTCATATTC
GCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGAAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCGACTCTTCGGT
CGGTCTCCAAATTCGTTGACGGCCTTGAGTCGGGACACGTGCACCCGGGTAGAACCTATACCCACTTCGGTCTGGCAATTCCAACTCGTACGCAAACTCT
TCGATCTTTTTCTTGATCCTGAATGGTCCATGCCATCGGTGGGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACCAAACTCTGCTTC
CGGGTTGGAACAGAGACCTCGGTCCTTCGACAGTGGGATCAGATGTTGCCCCCGTCTCCACCTGTGACTCGTCAGAAGTCTCGTTTTCATCGACATTCGG
TACTGCAGCTCTCTCACGTCGCTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACACTTTGGTACTCCATTGCCATTTTCCACGAGATT
TCCTGTTGCCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGCTCGCAGCGTGGATTGTG
CGTCCCACCCATGAACTAGGTAAAACGGAGTGTCCTTCCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAGATCAATCGCTCCGCGATCTCGTCCCAGTC
TTGCTGCAGCGGGTCTTCTGCGTACACCCGCACCGATTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGATAGCTCAGGGTC
GCTCTTGACCGAGACTGCATCATTTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAGGGTCTCGGTCATGTCGGATCAGAGTTGGTGCTCCGAATC
TTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCCTCAGAGCGGTAGTGTCTGACATAGCTTTACCCATGACGAATCCTGTGAACGCGCACTGGAACAG
TAGTAGGGCTGAGTTGCCCCGACGAGACTTCGGTAACGGTATGACGAAATCCATCGACACCATCTGGAACGGTCGCTCTGCTAAGACATTTCCTGGCGAA
TAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGTCGTTCGGCGTCTGCATATAGTCCAATCCAAAAATAGTCTG
ATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGTTGTGGGCACCAC
TAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGTTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACGAACTTGTCGGCC
ATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTTCATCCTGGGCGG
CGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTTGGAGCGCCAGGGTCCGCCTCGTTGCTCGATTGCTCGGCTCT
CAGCTCACTCTGAGCTTCGGTGGTCACACCATTCGCTTCGTCTCGCTCAGCTGTACCATTCGGCTCTATCACCGACGTTTCATCTGCAAACTGGACTCGT
TTCTGCTTTTGCTTGGTGTCTGGTTGTTGCAGTTAGGTAGTCGGGTTCGTCCCGCACAAAGTCGAAAAAAGATCTGTCGCGGGAGATTCCACGGGCTACT
TGGGCTCGGGCGAAGCTGACTGTCGGTTTCTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCGATCCGGTTCAGCTCGACCAATTCTA
ATTTCCTAGCCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCTTGCCAACGAATCTGCTGCAGCGTTGAATTCTCGGACCACGTGCAA
GTACTTCACCGACCGCAGCTTGGTCGTGAGTCTCGGTGACGATTCAGTTGAACCATCAGAGACTCCTTTCGACATGCCATCACCCCTAGGGACTGCTGGA
TTGCGAGTCTCGAGTCTCCCACGATGACTAAATCCTCGGCTCCATGTTCGAGCGCAGCTGAGACGCCGTTGTTCATTCCAGCATACTCAGCGAGGTTTAC
CGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCATATCCACCGTTCTTTTCG
GTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAGCAGTAGGTGACCCTT
TCGTCGGCGGTGTAACTGGGGCCAACGAGTCTTCCAATCCACGAAGCTTGTGAGGCCAGCTTGGAGAAGCTGAGCAAACGTACAATCGCGTTCCTTGACT
CGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTGGATTTGTGCACCCATTCGAGCGTCGAAAAAC
GCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGGCCGGGTGGTAGTTCAT
CTCGGCGTCCTTGAGGACTCGGCCACAAAATCGAACCGGGTGCAGCTTGTCATCATGGTATTGCATCAAAGTGGAGCTCAATGCCCACTCATTCGCGAAT
AACGTGACATGCACCTCCTTGTCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCCGAAGCTTCGTTTGGCCGCCGAGAGG
CTGCCACTAGGCGTGAAGTCTTCGTCCTTCAACTGGTACAAAGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGTAATAATTCAGCGCACCGA
GGAAAGACTGCATCCCTTTTTTGAAGCAGGGAATGGCAGCTCGGTCACTGCTTTCATCTTCTTGGTGTCGGCTCGAATACCTTCTGCAGAGACTTCGTGT
GACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGACATTCGGTGAACCGTTGGAGCAGTCGGTCTAGCACGCGTC
GAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATTCATCCGGTTCTCCGGTGGAGAACATGTCG
GCAACAGGGCTGTTCACTAACCCATTCACTGCGTCAAGCGTGACCGAGGATTCGCGGTCGGCCTCGAATTTGGTCGAGTTGTTGACTCCTCGAGTGTCGC
GATGAAGGGTCGGTCACCCCTGTCCGCGCAACCTCGGCGTGGGCTTCGGCCGTTCGCATAAGCTCCGAGAAGTGGAGCCAGCCGCCTTTGGGTTGGACGA
AACCCCACAGAGCATTGTCAATCATTCGTTGGTAAATCATCGGTGCATTCTTCAATCCAAACGGCATACGAAGCCATTCGAAATGTCCGAGTGCACAGAC
GAATGCCGAGACTTTGCGGGCCCGCATCGTCATCATAATAGCCCAGAATCCACTGGCCGCATCAAGCGAGCAGAACCATAGTAGGCTTCCAGGTCGGTCA
ACAAGTCGTCGACTAACGGCATGGCGTACTCCATAATCGCCGTCACTGCATTCACCAGCTTGTAGTCGATGCACAACCGAATATCAACTCCATTCTTCTT
GAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGACGAGCTTTCAGCAAGCCTTTCAGAAGCTCGTACAGCTTCCGAAGGTGT
CGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACACCACACCGTAGGCCGGTGGTGGCAGAGCATTCCCAC
TCGCAATCATGATCTTCTCGTGTCGTTTCAGCACCGCAACGAGACTTTCTTGTTGACGGGCTGTCGCGCTCGGGTTCAGAACATTCGGTCCTGAATAATC
CAGTACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCAACTCGATCTCATTCGCTAAATGTTCGGACGTATTG
GTATCGGTGTTCCCACTACCTGAACCGTCCCCCGCGGTAATCTCATGCATCATTGCTACGAAGGCAGAGTCCAATCGGGTCTCCGGGTCATCACCGAGGA
CTGGGATGGAGTCTCTTCACTCGTATACGTGGTATCCGCGCCATCAGAGGTGTCGGTCGCCACCGAGTCGTCATCTTCGTCGACCCATCTATCTCCAACG
GGTTCGTCAGAGGGTTGCACCGAAGTCGTCAACGGCATTCGGTCTCGTTCTGTCGGTTCCTCAGTGCCTATTCGCGAACGTTATCTGGCCCTCGTCTAGG
CCTCCAAGTCGTCGGATGGTCGAGGTAGGATGCCGCTAGGTGTCGGATAGTCTCGTCGTTCTACAGCTGGTGGCTGATCTGCCAACCATCGTTCGTAGAG
TTTGCGTTCCGCGCGAACAAAGTCTCGTCTCGACACTCCGCGTACGCCAGGACTTGCCACTCCTCATACTTAGCGGAGTTCAAACGAGTGTATCCATCTC
CTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGTACCGATTCGTGTCTCGCGCAGTGAGCAATCTTCGGTGACACGTTCGTTAGTCGCACCATCGTCGG
CTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACGTCGTGAGTAGTCAGAGGCGGCCGTCGTCGTGGTAACCTA
AATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGCTGTACGGCTCGGCCTCTGCTGGGTTCTGCGACTTCA
CCAGGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCCGGCTGGAATCATGAAGTCTGTTCCCAGGACCACGTC
ACTCCTGCACTGTGATCCATAACCCATACTTCAAATTCGTACACGCGCTCCCAGCCTAGCGTGACTTTAACGAGTGCTCGTCTGCGGGTCTCCATCACCC
CTGGGTTAATTCCTCGCACTTCCAGACTCCTACCGTGATCTGGAACTTCGCGCAAGCGCAACCGTTTCGCGTATGACGCGGAAATCACACTGACATTCGC
TCCAGTGTCCAGCAGAATCCTCGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAATCGCTTCCTCTTGTCATAGCGCTGGGATGACCACCAC
CCCATTCTCTCGCCAGATAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATTTTGGCCATGCTGAGGATCGAAGCATCGGTTAGCTCCA
CTCCGTCTCCGTCCACACGTCGTCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCTTTACATTTTCCGTCGTTTTCACATATTCCATATTCAA
GTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTGGCTAACTGTGGCAGCCCGATTGGGACCAACCCAGTT
TCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGAGGTCCTTCTTCTCGACCTTAGCTCGGAGGAGATTCGT
GAGTTCTTGGAAGGCTTCACACTTCCCGGCATCATGAACCTGTTTGCACATCTTGCATCGCTTAAAGCAGTAGTGAGCCGAATGGGTGAGTCCTCCGCAG
GCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTGGAGTTTCGGCGCTGGTCGTCTCGGTCATACGGGCGTTGGCCGTTACTTGCCCTCGGCG
ACGGTTGTCGGCGCGAGCGAACGTTCCTTCAGCCGCATTGCGACGTTCAGAGTCGTTTGCAGCAGCCACGTGGCCTCGGTCCTCGGTCGACGCGTATCCG
TCGTCCGAGTACCCTTCGGAGTATCGGTCGTCATCGCCAGAGTGAGACTCCGGCCCATACTCCTCGGTGTCATCATATCCGTCGTTGTACGCTTCCGGGT
ATCCTCCACGCGCGTCCACCGAGCGTCCCGCATTCAGTGCTGTCACTATGTTGGTCAGTGCGTCAGTGAGAGTGACCCTCGGTCGATATTGTTGGTCATC
CCGGCGACGGTTATCGTCTCGGTAACGGTCTTCTCGACGACGGTCGTCCTCTCGGTGACGTCGGTCTCGGCGATAGCCGTCCCGCGGATCCTCGGAGCGT
CCACCATCGCGTCGGCGTGCTACCTCTTGCCCTCGAGGGCGGCGGACCGAGGACTCGCGTCCAGATTTTCGCTCTCTGCGACGAAGGATATCATTGATCA
TATCCTCGAGGTCGTGAATGTTCTTAACTCGGACATGGCACAGACGCTCTTCTAGACCTCGGTCTTCGCACGAATCCAAGAAGTGCTCGACGTGGTCCTT
TGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTAAGTCGGTTGAGGTAGTCGCAGACATGCTCCTTCTCCTCTCGCTTG
GCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCTCGAACAGTAGTACTTAATGAACGCATCGCTCAACAATTTCCACGTGCGTTCGTTTTGCGGGG
CAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAATTCAAACGCCATGCACCATTCGTTGGGCGGCGTGTGCGTCCCTTTCATCTCGTATATG
AACGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTGATGTTTCCGAGTGGGAGGTGCGTGCGATCTCTAGCCTCGG
TGTCGCACTGTCATTCTCCACAGCGCTCAACTCACGAATTTGGCGTGCCCATTCTCCCGTCAAGTCACCCCCGGTGTCTCCGACGTCGAACGAATCTTCG
TCAGATGAGTCGTCGCGGAGGTCGTAACGTCGGCTGGGCGTCCGACTTGCGCTTCGTCCAGCAGTCGGAGCGGTTCGATATCCCTCGGCCTCTCTCGCCA
GTCGTTCTGTACGACTGACCGACCTTGGCGTCACCATGTGAGAGTCTTGGAAATACGTCGACGTCGCACCTTGGGCCGAAAATATTCCGGCCTCGGTCGA
CCCTCTGGGGCGTCTCCCAGGGGTCAGGCAAGGAATCATGGACGGGTCGACCGGATCCGATGCGTGGCGGACGTTCGGTGGACGGCTAACTCCCGCCTCG
GCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGAAGCGCCGTAGCGGCGTCCTCGGGTGCCCATGCTCGGAGGTCTGCTTCCGACGGGAACA
CTTGGGTTCACATCCCATAGCGCGTAGGAGTTGCACCGTGTCCTCGGCCACCTGCCGAGTATTCCACGACTCCACGGGCACAGTTAACTCGCCACCGAGC
TCCATCCAGATGGCTTGGCGAACAACCTCTGGAGCGAAGGATCGCATCCAGTTGCTCTTCACCTTCATGAGTTCTAGGTATCGACCCAGAACTCGGTTGG
CGGCCGGGGTGTAAGAGGAGGCCGGCCGCCATTCGGCCGAGAATTCGCATCCTCGGCCATCGCCGACGATCGGTGATCGTCGGACTCATCTTCGTCGTAA
CCGTTGGCTGGTTCGGGACCAGCCACTTCGTTCAACTCTTCGGTGAGGTTTCGCGCAAGCGACCTCACCCCTCCGCTGCGTCCTGCAGATACTGCAGCGG
CTTCCGAAAGCTCGGGCATAGCTGCCTTCTCTTCCAGGTCATCTTCTTCGTCATCTTCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGA
ACGCTCGTTGATCGACGCCAACGTACTCGGCGTCGCGAACGACGAACCGGAACGCCCCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCT
GGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTCTTCTTTCTTCTCTCGAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACAC
ACAGAAGGTCACACCAATCCCGGGTCGCGGCACCAGTTGTCGTGTAGGAACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACAC
GCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGATCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGT
TGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCGAGCGAGGGCTAGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGG
GTACGCCTAATACGGGTTTGCCGAGGGTAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATAGGGACCGACACTCCTTG
TCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGACTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCG
AGCGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTATCCT
ACAGCTCTGGGAGCCTCTGTAGGTCATCATTTGGCTAGTCCTATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGC
TCTACACAGCCGAGGGTACGACACGAAATGGGTACAAACGAGGCTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATAGCG
CGGGAAATGAGACCCGCCAATCAAGACGCTCTGTCGCCGTTCACTGAAAGGTGCAACGTCAGCCAAACCGTGACAGTTCGGCACCAAAAACCAACGCCAC
AGTCGCAAATGTCGTGGTGGTATCCCAGTTTCGTACGTTTGCCCCTCACTGTACCATTTGTACCTGGCAGCATGATAGCCTTAGTGTGCTCTCGTGACCT
TATCGAGGTTATTTCCAACAATCGAGTCTGAGTGGGGAAATGCGTAGGTTATCCGTAGCAGGTAAGAATACAGTGGTCACGGTAATGAATCTCATTGAAT
TTATTTTGTGTTGGGAAATATTTTTACCTACCACGCAAATTGATCAAAGTGGATATATATGAATGCAGGTTAAATTGTGTAAATTAATCTCACTGTTTCT
GTTTAAGGTTACACCAAAATTATATTCAGTCTGGATAAGCTATGTCATATATCCGAGTACAGCCCTCCGCCAGGCAATGTTCCGATAGTGGCGCCACTTA
CCGCCTCGTAGTCTCCTTCCTCAGCTTTCTCGGTGGTTGATGGCACCTCGTTGGCAAAGTGGTCCGGGTACTTGTGAGTTGTGTCCCGGAGATGCGGAAA
TAACTGCTCGACATTCCAGGTTCCGTCAATATCTAGAGACAGACCGCATCGGATCATTGCCTTCCGAGCGTAGTTGAGACCTTTCTTGTCTCGCTTCGAG
TTAACATTTCGTACGGCTTCTGCTGCGAGCTCCAAGAAAAAATTATTGCCGGGAGTTTCAGCTTGCCTGACCAGGCACCACCCTTCCAAATTTGTCCTGC
CATTGCCTTCTCTCAATAAGATCAATCTTCTTTTCATTCCATTTGCGAGCCCACACGTCTTTGATCTTTGCGATGACGAACGAGTCTGCTGGTGGTTGAC
ACAAATCCGTGGCGTTTGCTGGGAAATACCTAAGTCGGGCATTAAGTTTTCCAGCTCGGTCCTGCAGTCATCTTCACTCAAATGGGAGAAGCAGTTGTCC
AGAAAAATTGTTTTTCGCGCCTTAACTGGTCTCCACTCATTGATCTCCGTTCTCCAAGAAATTCATGGAAAATAAGCTTGTCCATCGAGCCTTTTGGTCC
TTTCGATAGCATACCCCTGGAGTATCGCCCTTCACGCCTCTAATTTGATAGCTTGAGTCTTTGTTCATGAATATCATCGTCGGCGGAAGAATTCTCTCTC
CAGGCCCTCCAGATATCCTTACCACCATTGTCATTCCTTCTCCTCCCGAGACGACGTCAGCATAGTAAGCCCAATAGTGAAGCTCATATTAACTTTTGTC
GTGAGATTCGTTTCAATCTCAGGATTTCTTTCGCACATAAATTAATCTATATGACATCCAATGAGATTATAAAGCGTGTGAGATTATTTTCCAATAGAGA
TTAATTACGGTGACCACTGTAGCGGATTAGCGCTACAAATGAAAGGTTGGAATGGCTAGCTATCAGTGTTCTTTCGCGCGATCGTGAAACCTCTGTTTCT
CTCGTGACTTGTGACTTTTCGAGAACTACGTACGTTGCGAAACTACCCAATGTCCGCCGGCAATACCTCCTCGACTGTTCAATGAGGTGAGCGAGAAAAT
CAACTTTGACCTATATAAAGACCACCAAGGATCACCCGCTTGTAATAGAAACCCCAAACTGCTCTCGTTTAACCTGAAGCACATACCGATATTGGCGATG
CGTTTCTGAGAATTCACGGCGAATCATACGTAGTCGATGTTGGAGAGATCCGCCAACCGAACCGCCCTTAGGGAAGCGCTAGCGTACGCTCAAGATACCC
CGGTCGATCTCATAGCGAGCACCTGCTAGTGGATGCTAACAACCGTGACGGAAACTTGAGCGATGAAGAAACGTGAGCCTGCACCTGCGGTATTTGGCCA
ATCAGCTACCGTGCGTCAGTCGAACCATGCTCAACGCGACATTCAAGGAAAGTCATGCCCATATATACTCGAACAATGCACAAATCTGCCAAGACGCAGC
TCCTCTCGTCTGTCGCGAACTTCTCAATGTTGAATTTGACGCTCACGGTCTTCTGTTCATGTGCTCCCGGCCCACCGATTTCTGAAACGGGTGTATGCGA
AAGACTGGGTTACGTGACAGCTAGAGGTTGGCCAGAGGCGACGGATGACCAGGCCACTCTGCAAGATCGCGACAGGCCCTATTATTGCACGCGCTTCTCA
AGTTGACACTTGAATTTGGGTTAGACAATTGGTCCAAAATGAGACCTTTTTATTACGAAAATGACATGCTCCCATTTTAAAGGACCTATCGCACAAAGCA
GCACTAAATATAAATGACTCTGTATGAAAGCGATTTCGGTATAGGGTGTACAGGTGCGGACGTGGTGGGTGCTTTTATTATCGCTGTGGTAGTGTGGCCT
CTCAGAAATTGCCTTCTGGGGGGCTTGGTCAACACACAAAGCGTGCTTCGCCCAAAGTGAGGTTGTGTGCGGTGTACAGAATTCCTGGGGTCTTGACTAG
TGTGATTGCTTGGGATGGTGGCCTACATTTCTGAATCAAGTGTCGTCAGCTTTGGTGACGTCTGCGTGAAAATATTCAGCGACGTCGGGTCTTGGAAGAC
ATAGCGTGTCTCAATTGCTGTTACTTCTTCTCCGTAGTGATATGCTTTGTCTTGACTGTTGCATTGGTCGATGAGTTGCTATTCCTGCCCTTGCAGAACT
TTGTTGTTATACCTGACCGCGGGATTGAGTTTTATTTGACTTCTTGTCAGACACGGATTGTGTGTGTATGAGGTGGTGATGGAGGTAGACAGAGAGAGAG
AGAGAGAAGAGAGAACACACAGCAAGTGTTTCTCGATCAACTGAAGCGCGCGTTGTACTTCCCAGAAATAGACGAGGGAAAGACTTCGTGCCCAAGAAAC
GTGTATTGCTTTGCCTGAGCTCTTGTCTGCTGCCCATACGATTTTTCAATGACTTGCGCCGATCTCAAACTACGTTCGTTTACCTCCATACACTGATTAA
GCAAAGGCGTTTCGTGTTCTTAGCACACTGTCCAACGATGCAATCTTATTTACGCCCTCCGAGAAGCGCCCCTTAAAGTTCAACCTTGAGGTTGAAACAT
CAAGCGTCGAGCATTGAGCACCGACAATTGATTATCGAACCTAGACTGAACCGAACCATACCGTTCCGTATAAATGCAATTTCACTTGCGTTCAACCCGT
CGTGTATTTCGAATGTTTCTCTAAGGGACCCAATTCTCGACGTGGCGCCTGCCGACTTCCTGTAAATCTCCGGGAGTCTACTGCTCCCCTGGCCACCTAA
AGTACCACACCCAAAGTTCGCCTCGGTTCGTCTTCCTTGCTTTTATTGCTGTTATATATCAATATTAACATTTCATTGGTCGAATCATACTATATGTCAG
ATGGTAGGCAACACGTCATCTGGTAGACCGGCCAAGCATGGGTAATCTTTGCATCCCTTGGTGCGTGAGCTGGATTCCGAAATAAACAAGAGCAGGAAAT
TTGTTGCTGCGCCGTAATTAGCCAAACGGTTAAAAGAAGTGCACGACATCTCGATTTCTGTGTGTTCTCTCCATCATATGCTTCGACGTATGGGCATACG
ATTTATAAAGGGGAAATCGCGCAATATTTTGGCAGAATCTACTGCAAATGTTGTATGTTCGACGCAATATCTGGGAACAAAACTGGCCAACCGTAACAGA
AGAAAATTTCCTGAACGACCGGAAGTGTATTTGGATGAAACATTTTGCAGCTTGCACCACGTTGCTAAACTGTCTGGGGTCGATCAGAATAAAACCGGTT
TACAAAGAGCGGTAACGGTCCGAAGAAAGATTATATTATTTATGTGTTACTTCCTCCGAACGAAAATGATTGGGATAATTGGCCAAAACGTTGCATAATT
CCATCAATGTTGAACATTTTCGCCTGCTGATTGATGAGTTCCTCGGAAGCGATTAGAGCTGCATTAGCATACCTTTTTCGGGTTCGTTTGCGCAAAATTG
ACTGAGCAATGAAAGTTGGCGTGGGCTGCCTGGAACATCAGTTTAGAATCACCCGCTGACGGTGCGCATCACACTTCTGCGACTGAAAACAGTGCACATG
GGAACCTTTCCGATTCTACAAGGCGCGCAATCGTAAACGACATTGCGGAACTCTACGGATGGCAAGGTGCCTCATGGCACGTACGCAGACTTGGCAAAGG
AATATGGCTGCCACTGGCACACGATCGACCGCGTATGGAAGCGCTACACGCGCTAGGTGTCGTGGGAGGTGCTCCCGAGAGCAAGATCAAAGGAAACTCG
GGCGCAAGCCGTACGATCGCGCCGAGCTGGCGAGAAGATTTTCGGCAATTCCAGTGACGGAGCGGCGGCGGGTAGCATCGACGGCGGCTCGTATCGGCGT
CTCTGGGTTCCTGGTGCGAACGCTGCTTGCGGAGGGGCATCTTGCGCGTCGGTCAGGGCGCATCAAGCCGCTGCTGAACGATAAGCAGAAGAGAGAGCGC
GTGCGTCATGCGCTCTCGTTCATTGAAGCGCACCTGTCAATTCGAGGGAATGTACGATGTAGTGCATATCGATGAGAAGTGGTTCAACGAGGACGTTGAC
GGTCGCACATACCTGCTTCTTCCCGACGAGGAAGCACCGCAGCGACATCGTCGAAGCAAGCGCTTCATTCCTAAGACTATGTTTCTCGCAGCGATTGCAC
GGCCAAGGTAACCTCTACAATTTTATGTGATGTAACCTACGCAATCTAACGTACCGATATCTCCTAGATACGACTACAATCGCAAGACCATCTTCGATGG
CAAACTCGGTATCTGGCCACTAACAGAGGAGTACGTCGCACAGCGAGCAAGTATCAACCGGCCCCGGGGAACCGTTCTCACCCGAAATATCGCCTCTGTC
GATCGCGAGGTTATCAAGCGGTTTCTGCTGGAGGCAGTGTTTCCAGCGATCAAGTCAAAATGGCCAGCGCGCGACCGTAAAAAGCCGATCCTCATCCAGC
AAGACAACGCCAAGCCGCACGTGTTTGCTGATGATCCAGACATCGTTGCGGCGGGGACAGCCGATGGGGGAATATCCACCTGTTTCTCTCAGCCTGCGAA
CTCACCTGACTTGAATGTTCTTGACTTGGGATTTTCGCTTCAATCCAGGCGATCCAGATCGAGAAACCCATCTACGGCATCAACGCACTGATAGCTGTAG
TCATTGATGCCTACGACCAGCTACACTACACCACGGTGGATGACATTTTTCTCACTCTTCAGAATGTCATGATATGTATCCTACGAGCTGAGGGTGGCAA
CGAGTACACGCTGCCACACATGGGGAAGCAGAGGCTTCGCCGCTTGGGTGAGCTGCCAGAAGTGCTGACATGTCCCGAAGACGTCTTCGATAAAGCTTGC
GGCTTTTACAGGTGGCGATCCTTTATCGAAGTGAGAACCTGTAGTAGTTAATACAGACCATGCTCAAATGTCCAATCATTCTACCACCTACAAAAATTAA
TTATCCCAATCATTTTCGTTCGGAGAAGTATTCATTATTTCTAAACTTTGCTATAAAAGAATTTGAAATCGTAGCCGCCGGTATAATTCGCCGTGAAAAA
AACTGGAATTGTGCGGAAGCTGGTCAAGGGATCGCGTGAGGTCAGCCAATCCAACCGAAAGCGTAAGCACGATGACGATTACCACGGGAATTTTAACATT
GAACAATTTGAAAAGTGGTTCACAAATCTGAGTGCTGTGTTGGCGTGCAAGTATGGTTTTATAGTATTTACATGGACGGTGCCAGTTATCACAAGAACCA
GACGAATGCTGCCCCGAATTTTAAATTGTAAGCTCAAATTTACATCTAGAGATTTGTATGACACAAACTACACCAAAACTGAGTTGATGATGTTCGTCCG
TGCAAACAAGCCCTCAACGATCTATAGAAGACGGAAATCTCCACTTCTTATGGACATTTAGTGTACTATGCGACCTTACACCCTGACTACCCGCTGTCGA
GCTAATTTGGGTCCATATTAAGGAGATTGCTGATGACCTTGCATCTAATGTGGCCGAGCTGCGGTAAATAATCCTATGGAACTGTGTATCTTCAGCTGTT
ATCGCGTTATAGAACATTACATCACTAAACAACGAATGCGTGTCGGGTTGCAATTGAAAACTACAAAGCAAGAAAAAAAAACTTGCGTCGGCAGCTGGCA
TATAGGGGAACAACTCAAAACGCGCAAAAACGCGCAGCAAATTTGGAATCGACGCCCGTTCTTATCCCTTATATCTAATTGCTGGAATACTCCGCTCCCC
CCTCCCATGCGCAATATGTGTTACAAGAGTTAGCGGCCAACATTTATTCTCTTGCGGTTGGTAACGTTAATGCCGAGAACCGAGCTGTCGGCCTGCTCAA
CCATGCGCCGGTGTTACACACAGAGCTCGCTGACGCAGAAGCGTAATTTGAGGGTTGCAAGGCCCAGCCCTGTAAACTCACACGTTCCCCGTGTCCAACA
CATAAGCGATCGCGCACTCGATCGACGAGAGACATGCTCTCCGACTGGAGCTAGGGAAAATTCATCCGTCACTAGAATCCGTCGGAAGCGTGCTGGCTAA
CGCTCGGTCTTCCAGTGACCTATCCTATGAATCCACGCCGCAGTGACGAATCCACAGTCCAGGTACAGGGTTACATGAGCCCTATACCACCTCGATGGTG
GTGGCTTTCTGCACACAACCAAACTCAGACACAACCACACCTGCCGCGCTCGCCTTCCAGCGCGTCGTGCCACATCTACCACAAAGTTGTGTCGTGCCGC
TTTCTGCCCTGGACCCATACATTGCTAAGTCGTGCTGTGGCTGCTGTTCGTCTAGCAGCGTCCGACGCTGTGTCCTGGAGCTTTCTCGCGTATAAATAGA
CTCCGTATGAGCTAACGAAATGGATCAATTGCTTGTACAGTTGATTCAGTTCGCCAATACTGACGATATCTGTGGTCGTAACCTGTCATTAAGCCACGTG
CTGAAAACGTTGAGGTGATCCATGGTCATGTATAGACAGGAAACATTTTCATTGGATTCTGCTATCGAAAGTGAAGCTACTGTTTTTGCGTTTTGCGGGA
TATGCAACGACGTCGCAGCTTACAAGGCATGCAATTCATTGCTTACAACAATTGATCACGTCCTGAAAGAGAATACGCTATCGAAGAGGGAGAGTGGTAT
CAACTTCAGTGAAGACTTAGCGGGAGACACTGAAGGAGATGACGTAGCATGTGCTGATCAATGCGCGTTGCATTTGAGCTCGTACACTACGGTGCAATCT
GTTGCTAGAACAGAGGCGTAAGCGTACCCTTTTGAAACGTGGGGTCAACACAACAGCAGAGAACCAATGCACGTCGATCACGGTCGAAGCGTGGCGTTTA
TTCCTCCGTGCATGAAGCGAACTTTTAAAAATTGGGTTTCTGTCGGAATTTCAAGGCTGCACACGCTATGCACGGATCAAGAACGGATGTGATTCCGTAA
TCGAATGCTTGCAGACCCCCCTCACCAATGTGGTTGTGCAGCAACCTGGTGGCGTTGTTTTTGTTAACAATCTCATTTATCACGCTGTTGTACTGAGCTA
CACTCCGGAAGCCCAGACATAGGACAAGTGGGGATTAGTTGGTAGAAATGTGATTATCAAAGCTGAAGATGCCGGAATCGCTTATCGATACGTCAACGCA
GCTGCCACCAGGGTTTCACAAGAATCAAAGACAGCCTGGATGAAAGTCCTTCCAGCGCTTACATATAAGGATCATCGTGACTGGAACGACGAACGTTACG
GTGAAGAGAAGAAATTGCTTTTAGATAAGCTGCAATTCGACCGAATTTTCAGAACCAGAAGCGGTAGTTCTCAGAAAAGGACTAAAAGGAAAAGATAAAT
TACGGAGAAGCTAGCAGCCGCAATAAAAGCTAATAGACATAGAAAAACGTATACGGTGGTACATAAAAAATATTGGAATTGATACAGTTTCGTTGAAGTT
GAAGTGAGGATATGGTATACATTTACAACCTTCCTGTTATCATGTTGACCCCTACCCTGCTTGTTTCTTTTTTTTACAGCAAATCTCTTCAATTAACCTA
CTCCGAATACGCAGCGCATTCTTTTCTATAGCCGACTCTCTAGTCAGTTTCTTGTACGTGTCAGCGCGGCAGTAATTACCACCTCCGTGAGGTGAGAAGT
CACACAGAGTCCAACCGGATGAAAGCCTCGTGAAGCATCTGACAGGCCAACAACTGCTGTTGGGTAGCCAGACTAGTTCAATTTGTGTTACATCGATATG
AAGTACAAAATCCGCAGCGGAACGAAGCATTTTCAGCATTGAATAAACTCTGACGACTAGGGGCTGTTCATCTGATCGATCTCCAAACATTGATACCCAT
TTTTGCTCACTTAAAACCAAAGAAAGACGGATCTCCATCATTCAAATAAACATGAAATTTATAACCCCCCGCTAGTGTCTCTATGTCCTCAATAAAATCG
GTCTCATTCAATTTGGTCCAACTTGTGGTAAGAAAGATATTTTGAACTTGACAGAGCGTGGGGGTTACGGCACGCTCAGGCTCAAACCGGTCTAAAATAT
CGTGACGAATACGATTCGGCTTTGTGTTTTGCTCAACAAGCTGTTCTGCAGTCGCTTCTTGCCCAATGTCAGCTTCGTTTTCTTGGAGACGCCTCGTCTG
TTTGATGCGTTCCTGAGCTGAAGATGCCGCTTTTCTTGGTTTCTTGGTACGTCAATACTTTAACTTTCCACTTGCATGGTTGACCAGAGTACTCGTTACA
ACTGGATGCCTTGTAAGCTATAACATGATAACGCATCTGGTAGAAATCCACGCGAGCCGGAAACGATGTCCTGTCCATCAGGGAAAGCTGCCTTCCGCTT
GCGGGCATCTGCAACCGATCCCGACTCTTATAGTTAATCGTTGATGTGTTCTTTTTGCCAACGTAGACCGCATATCTATAATAGACAGTATCCGCACGCG
CATAGCGTATTCATGATGTGTACTATATAACTTTGAAACTCCTCTTTTGTGATGCGAATCAGATGTAGTACGCAGTGTGCGCATAGCATGGTACGAGCAG
CTTCATCCCATGGCTTAACCTTCTTGTAGCTGCGCGTTTGGTTGAATGGAGACCGCTAGAAGCATTGATTCTTCACAAGCGAACTCAGCTGGAGGTAGTA
CCCACGGCGAAATGTCGGCTGCAGCACATGTACTACTTCGGAATTTTCCAGGTCCTGCCGATCTTCATACGTAGGTCAAGTTTGCTTGGTAAATGGAGAA
TTATGCGCCAAGGAGCTGAATGTTGTGATGCTAAAAGTCCCGGCTGGCTGCACATCGATGTGCCATCCGGCCGACATCGCATGGGTACGCCCGTTTAATC
TCCAGTTGCGGGACCACTGGCTCGCGGACATCGAGCAACAATTTCGACAGCATCAACACGATGGTGGTAAGTTTGTACTGAGTCCCCAACACGTGAGGTT
GTAGTAGGATGAGTTGGAATGGGTTGTCGAAGAGCACAATCGTAGGTGAATTCAGGAAGATTAGCGTGCTGTCTGATCAGGGACAGCCTCCGTTAGATGA
TGCTGAGGCATACGACAAGAAGCTGTAGAACGTGATCCATCTTTTGTTGAAGTTTAAGGCTGCAGATGACGACTCAAAGGATGTCCAAAGTGGTAAAAGT
AAATAAAAGCACAGTCACCTGCGTTGACAATGAAACATAGGGGATGTAAGTAGATACACCTACTTTTGTTGGAACCCTGGCACCAAGATTTCACCGGTGA
ATGATGTCTTAACTTTCCGAGTAGCCATGAGGAGGTTTCAATCCTTAGTATGTCGCATCAACGACAGTCGCTTTCACCAACTGAACAAGCGGGATGACCG
AATTACTTTTACATTACGTAAATTTCGTGCTAATATACATTACGAACATGGTGACTGTAATTTATTCGTATATCTTTTCCCATGGCGCGGGCAGCCTGGT
GCTGCAAGGGGTGCCTTTCGATAAGATTTGTACGGTAATGTTACCAATTTAACTCATTCCAAGAGTGATATTTTAATATTAAAATATTCTAGTAGTTAGT
TTGTCAAATAACTATTCAAATATTACTAATAAGACGAAATCCATTGCCCAATCCCTGAGTACAAGCTAATCTGTACAAACCAATTACGCCCCTGGAGGGT
AGGGAAAAGTATACGAACGATGGCGTGTTTTTGCTTGGGTGCTGCTGTACATATTTCATAGGTATTATAGTTAACATGGGGGCGCTACAGTAGCCGGTGC
CAACGGCGGTCACCTAACGCAAGCCGAGATGGCTCGTCGTTCTGAACATGTAAAGGGTGTGTCGGCGAAGGCAGCGCTCTCTGAGGCAACTCCATTTTAA
CTTACTGCTTGTTTTTCGATCGCCCTACGAACGGAGCGGAGCCAGCGGGGACTTGACCATTTGATACATGGGGCTCTGCGGAAACGCTTTGTCGGCTGAT
TGAATGCTTGCTCGCTCGATCGCGATCGAAATGGTGTCGTCTTCATTCCTCTCCTTCTCGAGCAGATCATCCAGCGTCGCACCGTAGCCGAGCGGGTGTT
TGCTCGGGTGGTAGATCATGTACACAGTCAGCTGTGCCACGCCGAGAGCCGCGCAGCAGACGTTGGTCACGAAGAGGAACCACAACCCAGACATGGGTGT
GTATATGATCCACATTGTGTTGTTGAACGTGCCAGCGATCACCATGTGAATCGGAATGAAGACGCCGGTCTTGTACTTGATGACGTCCTTGATTTTGAGG
AACGGCGAGCTGTAGAGCACCAACGTCACGCACACGGCGATGTAGCCCATGATAGAATTCACGGTGTCCCTACTGATACTCGTGAAAACGCCGAGCCCGC
CCAGCACCGCGTACGTAGTGATGATCGAGAGAACGGTTGCGTACACAGCAATGACTCGCAAGGCTTGCGTTCTGTCGGACGTGTAGCGCAGGAACACGAA
CATATAGATAAGGGAGATGAAATCCCCCGATACGAAGGTGGAGAAGACCGGGAACCAATTGTTGGTCAATAGACCCTGCAGCGTCCAGACGTGGCAGTTG
GCAAACACGGACACTAGCGAGACGATACTGGTATTGCCGATGGACTTGGTCTTGTAGATCTTGTAGACCGCCGGCGTGGGGCTCAGAATCATCATAAGCG
ACGTGCTGGCCGCGATCACGCGGAAGACGGACTCCACTGAGCTGGACATGTTGAACTCGGCGATGGATTGTTTGTAACTGCTCGTACTTGTACTCCACCG
GGTGAATCGCAAAATGAGACCAGTCAGAGACGAACTGCACCAAGCCTGCTTTGGGTAGCACACTAGCCGCAATCGTGTGGTTGGCTCGTACATGGAGAGA
GGAAGGCCGAGATGGGCTGGACAAACGAGTGGTTGAACTCTCGAGCCTTGATGCATCGTATGTAGCGTCGCGACTTCGGGTTGGTTGGCGCACCGGAAAC
CCTGCGCATCTGTTTAACGGCCACGAGAACGTGCGAGACGTCACAGTCTCAGGATTGGATGCGCCGATATACTGCCAGACTTCGTCCAAGGCGGTAATGC
ATGGACGGGCTTGGCATCGAAGTATTTCATTAGTGTGAGAATGCATGGACGGGACCAACGCTAGCGCCGCTGCCAGTGGCAGCCTGCCACCCGTTGCGTC
CAGCCTGGACTCCAGGCCCTGGATTCGAGGGCTCCAGCTTATTTTTGAATACGACGTCGCCACCGATTCTGATACCAGTTCTTTTAAGTACAGTGCTACA
CATAAAAAAAAATACACGTCGAAATTTGGGCACCACAGAGGCTCGTGTCACGTGGCGGTTTAAGTTGTTGGAAGCAGGACGAGATGTGAGGTTGATCTTG
GTATTTAATTGCTGATAAGTTATTGCGCCTGGTACGACGCATACGACTCAACTGCTCGGCTCGGTGACAGCCACCAGCGCTACAGCCGTCAAACTGTCCT
AATGGTCTGAACTATTCTAGAGCTAAGCCACTTACTGTCGAGGCGGCCCGAATAATGTGCAGGACGCCGCCAGTGCCGACGCGCTCGAACGAGCCACTCG
ACGGAGGGATGGAGAACTCAGTTGCTGGATAGAACTGCCGCGGCTCAGCGACGGCGAGCTCAGGTGGAAGGAATTCTCGCGGCTCTGCGCCGACGAACTC
AGCTGGAAGGAGCTTTCACGGCTCAACGGCAGCAGTGGTGACGACATGGGCCGGAAACTTGGGCTTGCGCTAACCACCTTGCCCTGCATTTCGGCCTTGG
GCGAGACCACGATCGTGATGGCGACGTCTTCGTCCGGCAGGTTCACAGTTTGTTGAACGGCCTTGCTCGGTCGGTACATCGCGTACAGCACCAGGAGCAC
GAGACCAAGCACGACACAGATCGCGTTAGGGATGAACATGAACCAGTTGCTATCCAGAGGCGTGTAGATGACCCACAACGCGTTGTTGGTCGCGCCACAA
ATGACCATTGGCAATTGAATTGGGGCTGCATTCTTGTTGCGTAGCACAAACAGAGCCTTCTCGAAAGGTGCACCGTACAGAATGATGGCGGCCACGATGC
TCAAGTAGCCGAGGACGTGGCTGATACCAGTGTAGTCCTGCCCCGTGGCACCTGTTGCCGCAATGATAGCGTACAGCGTGATGGCACCAAGCACGGCGAC
GGCCCCGCCGACAATCTGAAGCACGTACTTGCGGTCTTCAGCGAACTTGTAGTATACAGCAATATAGGTGATCGCGGCGAAGTCGCCGAAGCCGAAGGAG
ACAACGACGGGGAAGATATTGTTGCAGAAGTAGCCGTACATCATCCACATGTGTGCGTTGCCGAGCAGCGAGACGAACGGCACGACGGAGATGTTGCCGA
CGGACTTGTTCTTGTAGATCTTGTAGATGGAGAAGGACGGGCTCAGAGAGACCATGAGCGACGACAGCGCCGTCATGATCCGGAGTAGGAGAACGGTGGC
GTCAACCATGATGTTGTGTGTGTGGAGATTTACTGGGACTCGACTTCTTGTACGCACTTGTGCATCCGAGTGGAAACCACTTGCGCGCGGGCAAGCAAAT
TGCAGAGTGACTGTGGTGCAGGAGTGGGCAAGCCGATTCCCCGGCCGAGATTTTCGGCGGTCTCGGGACAGGGCGCAGAGGGCTGTCTGTCTGCCGTCTC
TCGTCTCGCCCACGATACACGTTTTCGAGTGGGCACAACTGTGCTGCATTCGCTTCAACTCTGATCCACCAAATCCGGGTCTCCTCCGGTCTCGAGATAT
TGGGACAACTCGCTGTTACCGGCCCCGGAAATGCAGCTCCGGCGATTGACAACGGGCTTGTCTCACTTTCTGAAGTTTTGACACGTCGCATGCACGACGA
TTCGTCCCCAAGCAGCATGAAGGGCGGACGATAGATGAGTCCGTGACAGAGCGCGAGTCACGCGTTGCTCCACAGCGAGGGCTGCCTGCCAATGACAGCG
CAGCACTCGCTCATTTGTCGGGTGCCGCAACGCGGGGGCTGCCCCTGGCGGTCGAGCCCAGAGCCGTCCGGTCACAATGCGACGGTTGATGGATACCGAA
GTTTCGTTCTCCTCGCTTGGCCTGTCATTAGCGCTAGCGAGCACACGCTGCCTGGACAGAGGCAGGAAGGAACGCGTGAAGCAGAGCGCCCCGCCACGAG
CACCGGCTGCAAAATATTCGCCATTTTCGTTTCTTCGACGAAGCACGCGCCATTGATTTTTTTTTACTCTTGCGGTGCAGAAAGATGCGGCAGACTTGCT
TGACGTGAAACCACTCGGCTTTTGCGTGGCAGTCGCGCATCTGTCCGCGATGGTTTACATCGGCAGGTATCAACCGCCTCGATGGCATCAAGACTTGCGA
GAG