Description :
From Genome Similarity Track
Location :
Scaffold_44:170855- 172610
Transcript NameFunction/comments
Phyra_79914cysteine protease family C01A, putative
Phyra_79915fumarylacetoacetate (FAA) hydrolase, putative

Sequence
1755 bases(100 bases per row)
TTGCTGGGCCTTTGCAACTGTCGCCGCGTTGGAAGCCGCACAGTGCATTGCCAACGGCGACAAGAAGGCGCCGTCGTACTCGGAGCAGCAGCTTGTGAGT
TGCGATACCAAAGACTTCGGCTGCAACGGCGGTGCCCCTGTGTACGCAATGGAGTACGTTCGCGACAACGGCGTCTGCACGAAGAGTAGCTACCCTTACT
CTTCCGTGGACGGCGGTACTGCGGCCGCGTGCTCGACGTCGTGTACCCCCACCAAGTCCGGCATCTCTGAGATCGTGCAGCTCCCCACAGGCGACGAGAG
CGCGCTCCTGAGCGCCGTGAAACAGCAGCCCGTGATCGTGTCCGTGGCGTCGGACAACAGCGCCTGGAAGCAGTACGTGAGCGGCGTCATTACGGCTTGT
GATACCACGACGGTGGACCACGCCGTGCTGGCCGTCGGCTACGACGCCACCACCATCAAGATCAAGAACTCGTGGGGCACGGACTGGGGCGAGGATGGCT
ACGTCCGCATCAGCCGCAGCACGCAGAACAAGGGCACGTGCTCCGTGCTCACCGACATGTCGTACCCCAAACTCTAACCGTCCAGCAACACAAAATATAT
GTCCCTAAGTGAGTCAGTCAAAAAAGGCAACTTCAACTTGCATTCTGGGTACCCTTATGTAGCCCTACGTAACCCTACACATAACATAGCTAGCATAGAC
CAGTCTAAGAAAAACATAGCCGAGTGTATCCTCACCTGATGCCCGCGCTGCTGCGCCTCGTATCCAGTCCCCGAAGCCGCCTCGCGCTGCGCACCATGAG
CTTGACCCCCCGCCGCTTCGCCTCGTCGCACGCCGACGCCAGGGCCACCGCGCTCACGCGGTTCGTGGACGAGAACGGCGCCATCCGCTGCGGTCAGCGC
ACGGATGACGGGTCCACGGCGCTGCTGGTGGAGGACGACGACCCCCTGGGCAGTCTGAGCTTCACAGGCGAGACCGCCACCATCGAGAAGGTGCTGGCGC
CCGTAGTGCCGTCGCAGATCCTGGGTATCGGCCTCAACTACCGCAAACACGCCAAGGAGACCAACATGCCCGAGCCAAAATTCCCCGTGCTCTTCACCAA
GGGCGTCAACGCCTTGCAGAACCCGCACGACCCCGTGGTGATCCCCCGCGTGGCGTCGGAGCCTCCCGAGGTTGACTACGAGTGCGAGCTCGCGGTGGTG
CTCAAGGAGGCCTGCTGCAACGTGACGGAGCAGGAGGCGCTGAGCTTCGTTGGGGGCTACACGTGTGCCAACGACATCTCGGCGCGTCGCTGGCAGGGCA
AGAAGGGAGGAGGCCAGTGGTGCCGCGCCAAGACCTTCGACACCTTCTGTCCGCTGGGCCCCGTGCTCATGACCCCCGAGGTCATCCCCGACCCGCAGAC
GCTCGAGATCGCCACGTACCTGAACGGCGAACAGGTGCAGAAGTCCAACACGAGCGACATGATCTTCTCCGTCGCGAAGCTGATCAGCCAGCTCTCGCAG
GATTGCACGCTGCCCAAGGGAACGCTCATCCTCACGGGAACCCCCGAGGTGAGGGACTGTTATGGTGCGGTTTTGTTGTGTGCGGTAGGTCTTAACTGTG
TTGTGGTGTGTTACTTTCCAGGGTGTTGGCGTCGCGCGCAACCCGCCTCTTTACCTCGCCCCCGGCGACATGGTGGAGATCGAGATCGAACACATCGGCA
AGCTCGTCAACCCTGTCGTCGGCGCCTCGGCGCTGTAAGCGCATAAGTGGCACCC