Description :
From Genome Similarity Track
Location :
Scaffold_96:170813- 172188
Transcript NameFunction/comments
g7514.t1XP_009515075.1 hypothetical protein PHYSODRAFT_472847 [Phytophthora sojae

Sequence
1375 bases(100 bases per row)
CAGCGACGGCGACGCTCCTCGTACTCCGCCTGGATCTCCTCGTTGGTCTTGCCAGCCGTCTCCGGCACGAGCTTGAGCGAGAGGAAGTAGAAGATGATGA
GGAAGACCGTGAAGGGCGCGTAGCTCCAGTCGTCCAGCTCGTCCGCCAGGTACGGGTAGCCGACGCCGACGATGAGGTTGCAGAGCCAATTGGCGCCGAT
GCAAATGGAGGACGCGCTGGCACGCACCGAGTCCGGGAACATGTCGGCCGTCATGACCCAGACGAGCGGACCGAGCGTGACGCCGAAGACGATGACGTAC
AGCGCCGTGAAGACGATGGAGAGCTCCGAGACGTCCACGAGGAAGGCGACCGTCATGCCGATGGACATGACGACCATGCCGGCGATGCCCCAGAGGATCA
TGTTGCGGTTGCCGAAGCGCGTGGCCAGCACGCCCGTGAAGAAGGCGGGCCAGATGTTGATGAAGTCGATGATGAGCGTGCCGATGCGCGAGTCGTCGAT
ACCGGCGTCCGAGAAGATGTCGCCCGAGTAGTAAAACACGGCGTTGATACCCGAGAGCTGCTGCGTGCACGACAGAAGGAGTGCGCCCAGGAACTGCATA
CGGTACTTGGGCGAAAGCACGGACTCGGCCGGCTCCGTGTTGGTGGAGTAGCCCGCCTCCGCCTCGCCCAGCTGCTTGGACGCCTCGAGCCAGCCCAGCG
CCGTGTGCACATGCTCCTCGCCATATAGACGCGTGATGACCTGCTTGGCCTCCTCGCGGCGGTTCTTCATGAGCAGCCACGCGGGGCTCTCAACGGACAG
CGACGGCGACAGCAGCATGAAGATGACGGCCAGCACGATGGGGAAACCGGCCATGTAGCGCCATCCATCGCCGCTGTCAGCGAAGAAGAAACAAATGGCC
GGCACCAAGATGCCGATAGTCGTGGAGATCTGCAGGCCGAGGCCCAGGTGGCTGCGTAGGTGCGGCGGCGACAGCTCGTTCACGTACGCGCCGATGGTGC
CGGTGGCGGCACCCGAGGCGATACCGGAGACTGCGCGGCCGACGGCGAATGGCCACACATTGGAGACGGACGCCTGGATGACGGCGCCGCCGATCATGAA
GAAGCAGTTGAAAAAGAGCAGCTTCTTGCGGCCCATCATGTCGCTGAAGTAGCCGCATAGCAGACTGCCGACCATGGCGCCGAAGATCCACGAGTTCACG
GCGAAGGTCCACTCGAGCTTGGAGTGTCCGGAGAAGAGCGTGCATGTGCCCGGGACGACGGGTCGAGCATTGCACTCTTCCGTGTTGTTGTAGTCGGACA
GGTTGAGTTGCGAGGTGGACCATCCGCTCTGGAAGGGCTGCAGCAGCGCGAGTAGCACGCTCGTGTAGAGGATGC