Description :
From Genome Similarity Track
Location :
Scaffold_536:17080- 19245
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_536-snap-gene-0.13Dynein heavy chain
Pytap_DAOMBR444snap_masked-pag1_scaffold_536-abinit-gene-0.19Dynein heavy chain

Sequence
2165 bases(100 bases per row)
AACGAATCAGAGGATGAGTCTTGTCGAAGGACTGGCATTTCTTCAGAATCATTTGGTAcGCTTCGCTCCACTGTATTtCTTTCGGAATCTTCTTCAGCTC
TTTGAGAGTCGACTGTATCTCAATCTGAAGGGAGTTAACGTCAACTTGTTTGAAGAGAATCTGACTAGTGcTTATGaaaaaaGCCTTTGTGCGCCGGATA
ATACCCCAAACGGTCTTCACCGCTTCCACATCGCCGCGCATAACCCCCATCATGCGTAGGGATTCGTTCATGAGCTGTGGGAAACCGAAGATAGCGCAAA
GCTTGGTATTCTCTTCACACTTCTTCATTTCCATTTCCCAGTCCACCAAATAGCTTTCAATCTTCTCCAGTGCTTTGTCGGCTTCAAGCTTGTACGTCCA
GAAGTCTAGAGACTTAaGCGTTTCCATCTTCTTCGCAATCGTTTTCTCGTACGACACGATGCGGTCTTCAGTCTTCTCACTAAATACACGGGTTGGTTCT
TGAATGCGATTCTCTGTGAGTGGAACTTGTTTCTGCACATCGTGAAAAAGCTTATCCATGTTGTCGATATCGACGATCTCTTTATCGACATGACCACCGT
TCTTCTTGATGTGGCTAAaCATTTGTCGCACTTGATCCATGATTAGAATGTTGCTATCTTtCTCGACCTCAAGCTTTTTAAtAATCTCCTTCACTTTACG
GAGCGTCTCAAGACCGTCTGTcTCGTTGCTAGGAATGTCCTTCTTTAAgTCAAGTAGCAAACGACGGAATTCGCCATTGCGCTTGTTCATGCTTCCCATC
ACTCTTCGAATCATCTCAGCAGAATCGAAATCCTTCTCACCAGCGAGAGGAGGCATGCACTTCGCCTTGTTTTCCTCAGTAAGAGGCTGGAAGTTCACAA
GAAATGGAGAGCCTCTAACCGGACCACCTATCCCAGCGAAAGTTCCGTCAAATACAACCGATAGATGATACTTTCCGGCGGCTGGCGCTGTAAATGTCAC
AATATACGTGCCGTCATTTTTGtCTACGATACTCGTGATAGTCCGCTCTGCTgcATCATCACCTTTGGCTGTTCCTTCAGCACTCTTGAGCGTAATCGTG
AACTCATCTCCTCCACAATCGCGCGGATAGTCATCCTTAtCACGACTTTGGATAACGAaTGTCGTCGGATACTCCGCAAGGCACATGTCATGGAGTGCTG
AGATCAAGCATGGaCcAAaGGCAAGCGATTTCGGAGCGGCCGTGACGGAGTGGAACTTGAATGCTGtcgAGACATTTGTgTACGGCATACCAGATAACGA
CGCGCGCACTTCAGCCAAAAGTGGCCATATTTTtCAAAACTTGGAGCTGTCGCCTGAATCAGCGCTTCATTCAGCACAGCCCCTTGGACGTCAACAAAAC
CTTTCGCAACAGCAAATCGAAGCGTAGCGTTTTGACCAACAAAGTTGTATCCGTGAACTTTGACTTTGGCATTACCGGTGATCGGTCCTGAAGTTGGTTC
AATTGCGGAAACTGCATAGGgCGGTCCAACCACTTCGCTTGCATTGAGAACATGAAGATCGTTGAACCAGCGGTTTGCCCACCCACCGAAGAAAATCATG
TAGTTGGTGTTTTTGTCAAAAACCATGGTCGTGTCTGCACGAGGAGTTGGTGCATCACCTCGAACGGGTGGAGATTGCCATTGCATCGATCCAGTGTCAA
GCACCAGTACTGAGTTCAGATACATACCTTGTGCGGTCCCGGAcTCGGCTAGATCTCCGCTGTtCCCCCCAAacATAAATACTTTCCAGTGCGGAACTGC
cGCAACACTCACACATGTATGATTCCATGTCGGCGAAGGTAGCTTAACCTCTAACGTAGTCCACGTTCTTGTCACCAAGTCGCACaCGAAAATGTCTTGA
AATTGCTTgAaGGAGTTCCAGCCACCAATCACAAACAaCTTCTCCCcAACAATGCACGTTTGGTGTCCTGACCGAGGCTCAGGTTTATCTCCTTCTGTTT
GAATCTCCTCCcATCGCCAATGCACTAGATCGAGAGCGTATAGATCGTTGAAGTCGGTTCGGCCATATCCGTTGCCTCCGTAGCCaCCAAATATATACAT
CTTGTCGCCAACAaGCGTTGCGGTATGGGCACCACGGCACTGGGGCAGCCCTTCCcAGAATCCAT