Description :
From Genome Similarity Track
Location :
Scaffold_115:17075- 18522
Transcript NameFunction/comments
Albla_Nc14073540Amino Acid/Auxin Permease (AAAP) Family putative

Sequence
1447 bases(100 bases per row)
GGAAGACGCACGAGTTTCATTCAATCTCTTTTGCTGTGTCTACGGAATCGGAACGCTGGGAATGCCCGGGAATTTCGCACGAGCTGGCCCGTTCCTCGCG
ACCGCTGCACTTGTATTTATGGCTTTTGCCAATACATACGCGTCAGTAGCCTGCTCCAAAGTACTTCTGCAATGTCCGAGATCGGTAGGAACCTACGGAG
ATCTTGGTGAATGGTGTTTTGGAAAGGCAGGGCGCTGTATGGTTGTAAGCACTCAGATTGCTAACTGTCTGATGATACCGTGTGTATTTTTGGTGCTTGG
TGGAATTCTGCTAGATGCCCTTCTACCAAACACGTTCTCCTCGTCCTTCTGGTCTATTCTCATGGCGATTACCCTACTACCGGTTTGCCTGATTCCAACC
TTGAAAGAGGGAGCAGGTACCGCGTTAGCAGGCTGTATTGGAACAATCATCGCAGACATTATCGGAGTCTGTGTAGTACTCAGCGGGATGACCGGACATC
CAACTATACCCCAGCCTGATCTAGATTTTGAGCAAGTGGTGGGGACTTTTGGCAACTTGTCTTTGGCTTATGGTGCAACAATTGTCATTCCAGCACTACA
GCGGCAACACAGCGACCCAAAGCGTATGCCTCGGGTTATCATAGTAACCATGACACTCATTTCGTGTCTTTTTCTCTTGATTGCCTCAGCTGGCTACGCA
GTTGGTGGATGTCAATTATCCTCTAATCTTCTTTTTGCAATTTACCCTGACCCAAGGACGGGTCTCAACTCGCTGGGATTTGTGCCACATAAAGGAGCTG
TGGTGGTTGCATTCTTAGCGATGCAAGTGCACATTACGACAGCTTTTGGAATCGTAATCCATCCTGCTTTTTATTTATTGGAACGTACGCTGTTGGGGAT
GCATGCAGACAATAGAGCCACCCAAGATCTCGAGTTGAACTACATGGATGCAGCAACTCCTACCAACAATGCTATGATTCGATCTGAAAAAAATTCGGCC
GTCTCATACATCACTTCGGAATCAGAGTTTGAGGATCAATCAACGTACAGAGTCGAGCTTGCAGAGTATCGTCAGCCAAAAATGGTTGTCAAGTACACAG
TTTTACGAACTGGCATCTTAGCAGTTTTGGTGGTGCTAGCTATTCTGTTCAAGAAACGACTACAAGAATTTACTGATCTTATTGGTGCCTCAACAATGAC
TGCAAGCTGCATCATACTACCGATTGTATTCTACCTTCAGAAAGAATGGGAAAAAGTAACTATTTATGAGAAAGGTGGCGCGGTATTTATCCTTATAGTG
TGTTCTCTTCTTGGTGGATACGTCACATACAATTCAGCCAAAAGACTTTTTTTCCCAGTACAAGAAGTGCTCAAGAGATTCCCATATTGCGCACCAGCGT
ACGAAAGTGTGATGTATTATATCACATTACCTCGTGAAGCCTGAGCT