Description :
From Genome Similarity Track
Location :
Scaffold_195:17070- 21085
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_195-fgenesh-gene-0.2Mahogunin
Pytir_DAOMBR486maker-pir_contig_195-snap-gene-0.20Protein kinase

Sequence
4015 bases(100 bases per row)
GCGGCGCAACAACCCGGACGGCACGCTTTACGGCGAGCCTCTGGGGTCGCACCCAGCGGGCGCCGTGAACCGCGCCAACTACACACCGGCGCAACTGCAG
GCGCTCTACCTGAGCCGTGGCCGCCCCGACCTGGGCTTCATGTCGAACCAGTCCATGCTCCCCAAGGACGTGCCGGAGATGCAGCAGACGAGCACGGTCA
AGAATCACGTGAACCTCAAGAAGAGTTCGCTCAAGCTCGTCGCGCCGACGGGTTCAGCAGCCTCTGAGGCGACGCTCACGAACATAAAGGATCTGTTGAA
CCTCGAGTTCCAGTTCGACGCAACCAAGCCCTGCCGCGTCACCGTGTTCCTCGTGGCGCTCGAGGAGATCGACGACGAGACGGGCTGCTCGCGCTACTCG
TTGCAGCACAAGACGGGCGCCAGCTCGCAGTTCTCGTACGAGTTTCCCGTGGGACTCTCGCAGAAGTTCAGTCTCGAGGACGTGGCAACGCCCGCAGCAG
AGACAAAGACGGATGGTGATGGCGATAGCGACAGTAATGCGCACCTCTTTGACCTGGGTCGCTTCAGTGAGTCCGAGCTTATTTACGAGGAAGGCTCACT
CAAGTTCCCACTCATCATTGTGCTCGAAGCCCTAGAGAGCAACAATAGCAACAATGGCGATAAGAGTATTAGTACTACCACGCCGCAGTCGCAGTCCACG
TTCTGCACATTTGCCAAGCAGCCGAATGCCAATGGCGCATGGACGATCAAGATGCTCAAGCAGAAGATCCAGGTCGATGGACTCACGTACGAGCTCCAGG
AGATCTACGGCATCGATGGCTCGCTGGCCGCAGCGCCAAAGCACGACCCGAACAGCAGCGAGGAAGGCGCCACCACAGGCGAGAAGAAGCGCGGTGGTCT
GGATGAGATCGACATGCCCGACGGCGCCGAGTGCATCATCTGCATGTGTGAGCCGCGCAACACGACCGTGCTGCCCTGTCGCCACATGTGTCTCTGCGGT
GAGTGCGCCGAAGCGCTGCGCAAGAGCTCGAGCACGTGCCCCATCTGCAGGACACGCGTGGAGGGCTTGCTGCAGATCCGCGTGGACGCCAAGGACCAGT
CGGACTCCAAGGACTAATAACTAGGAAGGGATGCGATAAATATGAGAAGCTTCCCAAACACGACGACTTCCATCCACGATATCTAGATTTTGGCATTCGC
CCATTTAAAGTATGCTGCTGCTAGTTGCTTCACCTGTCTTGTTTCTTTGGTTTTCTTCTTCTTCGTGTTCTTCTTGTCTGGTGGTGTCGAAACTTCTCTA
ATTTCTGTGATCCCATACACGAACGCACGCGTCTTTGTCTTCTTCATCATCGCTTTCTCTCTTGTACAAACAAATGCGCTCAACTCCGTCACTCTAGCTC
ACTCTCACGCGTACATCTCGTGGCGGATGCTGGTACTGTGAGCTTCTCTTCTTCCTGACTTTTTCTTGGGATCAACGGGCGACGAGGCAAGCTGCTTTGC
TGGTAATTCAAACGTAAAACAAAATTAAGTAGAGGTACTGCTGCCGACACTGCTATTTTCCACTTGTCGAGTTCGACTTCGGCAGGCTGAGTGAAGGCTG
CCTTAGTTCTTCTTCCACAAGCCCTTCATCTGAGTGAAGCATACAACCACAGGGTCTCCGTCAGCACATATACACACACATTCTACAAGATACCGCGTCA
TGCTAACAATGTTTGACTTACCATACTCGTGACTTGCTCGGATGCGTTGGGCGGGCGAGTCAGTGAACCCGTCGGCAGACTGCCGCTCTCTGCTGCTCCT
CCTGCGAAGTACCCAGAGCTGCCACTGGCTGACTTAGAGTACCCTCCACTTCGGCTCAAGGCCGAGTCGCTGTTGCTCGTGAGGTAAATACGCGGCCGGG
CCGGAGTGCTCGGACTCGCGTTGGCGGAAATCGGCTCTTCCAGCTGCTGCTGCTGTGGCATTTTCTGCTGGAAGTCTTGGTGGTACTCTGCGAGACTGTG
CATACCTCCTCGCCCGCTGCGTCCAGGGCTGCCCGAGTTGTTGTTGACGTCCGGCATCCTCTTCCGCGGGCTTAGCGAGCCATTGTTGTTGCTGTAATTG
TTGTCTGCGCTAGAATTCGAACCGTCCGAAGTCGTAGGGGAAGAAACCTTGGTGGTGTACGTGACTTTTCGGCTCATCATCTCGACCCTGGGTATATTTG
GGTTTAAATTGCACAGAGTCAGTGCACTGTGCTGCTTGGATACAAACGCTCTTCTGCCTAATCTCCATCATACGTACATTTGCTCACGCTTCTTCAGCTC
ACTCTCGCGACGAGCGTAGTCCATCTCAAGCTCTGCAATAACAAGACAAGCACAGAGACTTATCAGCAAGACTAGTCGAGCAATCGACTCAACATCGATA
ACCACAACCGTCGCTCACCTTTGAGCTTCTTTTCGCGTGCGATCAGCGCGGCTTCTTGGCGGCGCAAGTCCTCTTCAATCGCTAACAGCTCCTTCATCTT
CTGGCTGTACGTGTTCTGCAGCTGCTGTTCTGGTGATGGAGCATTCGCTGCAGCATACGCGCGCAGTCGCTGCTGTAGCTGCGGTACGCGCTCCAAGTCC
TCGATGCGAGGTCGTCGGGAGCGCTGTCTGTGAAGCATCCATCGAATGACTTGGAAAAGTCCCTCCGAGTACTGCGCCGGGATGCGGTTGAACTTGCCCG
CGTTGATTTTCTTGGCGAGCGCAAGCTGGTTCGTCGCATCGAATGGCGGACTACAAACGTGGAACGAAAGCAACTGTTAGACCCACACACAAACTTTCCA
TACAGAAACACACACACATAACATGTAGCTATTCCACGTACGCAAGCGTCGCCATTTCGTAGAGCAGACAGCCCAACGCCCAGATGTCTGATCTCTCGTC
ATACGTCATCTCGTTCACCATCTCCGGACTCATGTAGTACGGCGTGCCGACGTTTGTTTGCGCAAAGCGGGACTCGCTGCTCAGCTCCTTCGCAAGACCA
AAGTCGCCCAGCTTGGCGTTGTTCTAAAGTATCACACAAACACGTACAGCATGAGTCTCCAACGTCGCTACATTTGAATGGGAATGGGTTGTAGCAACAA
GAACGCACATTGGAGTCGAGGAAGATGTTGCCCGGCTTGATGTCGCGATGCAAAATCGGGCGAATGACGTTGCCTTCGCGGTGGCGGTGGCATTCCTTCA
GCGCCAGGAAGATGTGTGTGAAAATATGCCAGATGAAGCCTTCCTCAATGTACGACCTGGTGTGTGTCATGGGCACCAATTAACAAGGAGATAAAGACAG
ACATTCTCCGTGAGTCACATAAATCCCTCTCACAACCAGACGCTCGCCAGAAAGAAGTGGAACAGGAACATTAGGACTCACCCTTCGCGCTTCTTGCGCT
TGATGTACTGGCTGAGGTCGCCGCCCTCGCAGTACTCCATGACGATGTAGATCTTGGTCGCCTGCTTGTCGATCACGCGGTCGAGGTAGCGCACAATATG
CGGGTGGCGCAGCTCGCGCAGAATGTTCACCTCACTCACAATGAGCTGCTTCTCCTTCTCGCTCATCTGCCCATAGTTCACTTCTTTCCACACAAGCGCC
TACATTTTTGGCAATACATTGTCATTCATTAACCACTTCTGACTCATTTTCACGTACAGTCACTAAACGCGCGGAAAATGGGGGAAGCCATATCCGCTAC
CACCGCATCTGCTTGAATAAGCCAATCACACACACACACTGCACCACACGCGACATGCCACGCACACACGCAGACACACACGTACACGCAGCCATGTCCA
CACACACACACAGCAAAACGAATCAGAACGCACCTTGCCGTCGGCCTTGCGTACGATTTGCGTGACCACGCCGAACGAGCCCTTGCCGATCACTTTCACC
TGCTCGTACGCGTCCATGTTGCTGCTGTCTGCTTGCTTTCTCTCTCGTGGGCGAAGAGGGGAAGAGGGTCGTGTCTCGTCGTCAGTTGGTCGTCAACAGA
GGAAGGAAGAGTGCG