Description :
From Genome Similarity Track
Location :
Scaffold_21:170665- 172765
Transcript NameFunction/comments
Hyaar_Emoy2803580nuclear mitotic apparatus protein putative

Sequence
2100 bases(100 bases per row)
GTATCATAGTTTCGAAGTTTTGAGGCGCTAAATAAATCGATCGATGGCGTCGGGGGGCGACGCAGCCGCGCTAGCCGCCTCTCACATTAACCAGGGTGCG
TCTACGTCTCTCACCCTAACCCTCTTGTTCATGTTTCTATTCTGCACGTCGTCGCACTGTGCGCATCGCCACATGTGGCGTAGCGGTAGCCTTGCGCCGT
GCAGCTTGATGTTTTTACTCGGTATCGTAGTAAAAACTAACGTTTTAACGTTTAAACGAATAAACAGAACAATTGCTGCATGACCTCGAGAGCAAGTACC
TGAACGTCAAGAGCGACTTGGCCCTTGTCGAGCGCAACTGTCAGACGCTGGCAGCAGACAAGCAAGCAGCTTGTACGTCCGTACTGACTGACTGTGCTAT
ATCCTTGACGTCGATGTCCGGTACTAATTTGTGACTGGTGCTCTACAACTGTAGTGGAAAAAGCAGAGCAAGTGGCTACACTTGCCGAGGAACATGAAAA
AGTGGCGCGAGAAGCGACGCAACAGCTGCTGCAGGTGACGGCGGAAAAGGACGCACTGACGTTCAAGCTTCAGATGGCTACGTCTTTGGCTGAGCGTCGA
CTGTCGGAGGTCGAGCAGCTGCAGACGACAGTTAGAGAGCAAAACAAAGTGCTGGTCGATGCCCAGCGCCAGGAGATGCAGGCGCTGGAGCGCGCGGCCA
AGCAGGAAGCACAGGTCGCGCCACTGACTCATGCTCTGACGCGGGCTAAAAAAGAGACGGAAGCTGCGCAGCAGCACTCGCAGTGGCTTGAGACGCAGCT
GAGCGAGAAGACTCGGACGGTGCAGGAGCTGCGACACGAGCTGACGAAGCACACGCACGATCTGGAGGAGCTCAAGATTCGTAGCACAGAAGAGCTCACG
TCAGTGAAGCGACAGCTGGAGAGTGCGCGTCTGGCAAACCAGAAGATAGAAGGCGCGTTGATCAAGAGCACAGAGGCAATGAAAGAGCTGCAGGCCTCGA
AGGTGCACGATGAGGAGGTGCTGCAAAACGAGCTGAATGCGCAGCGTCGACTGGCTTCGTTGTACCAGGAGTCAGCAGCGGAGTCTTCTGCTCGTGTTAC
AGAGCTGCAGACAGTGTGCGAGTCACTACGCAAGTCGTTGTTTGACGCGGAGCAAAGACTGACACGTGAGACAGAGCGGGCGAAGGAGCAGGTCGAGCAC
TTGTTCCGAGAGCAGGCTGGAGCTTCCGCGGCTCGTATTCAGGCACTTCAGGACGATCTGCAACGTGCCGAAGAAGAAGTCCAAGAGATGGAAAAGAAGA
AGATCTTCTCTCTGCAGACAGCCAGTGCTGTGGCCGGACTATCTTCAACTGCAGGCGAAGCTCACTTGGCTGCGCATGGATTGACCCCTATGCAAATGTA
CGATCACATTGTCGAGCTGGAAGAGACACTTCAAGCGGAGCGCAAAGAGAAGGACAAAGTACAGCTGTACATGGATCGCATCGTCAAGGAAATACAGGAG
AAAGCACCCATTCTTGTTGGTTTGCGGCTGGATCACGAGCGCATTGTTGCTAGCCACACACAACTGAGCGAGCGGTTGGAGCAGTGCACGCAAGAGTTGG
CAAAGAGTAAAGCTAATGAGCAGCATGCGAGAGAGGAGAAAACCGCGCTTGAAAAGAAGTGTGAGTCGCTCGGTCAGAATGTTGATGACCTGTCACGTCA
AGTTCAGCACTTGCTTTTCCGCTCCCAGGATTCGTATAAACGACTCGACAATCTTGAATCCGGCGATGTTGAGTCCGAGAATCTAGTGGTGTTCAAAGAC
GTAGAGGAGCTGCAAGTGCGGAATCAGCAGCTCTTGACGGTCGTTCGTGAGCTCACTGAGATGAACAAATCCGCGACAAGTAATGGTGGTACCGAATCAA
CGGACTCGGCTGCACATATAATCGTTGCTAGTGACTTTGATGATAACGTCGACCAAATCGGTGCATCTAGTGCGATTAAGAAGCGGTTGTCGATGGCTTG
CAAAGAGATTCAGGAACTGCGTAGCGAGCGGGAGCAGGAGCGCGAGATGATCGCAGCCATTGTGAAGCAGCGTGATATGTACCGTGTGCTGCTGGCCCAG