Description :
From Genome Similarity Track
Location :
Scaffold_27:17054- 19031
Transcript NameFunction/comments
Phypl_g1103conserved hypothetical protein

Sequence
1977 bases(100 bases per row)
TCGTTGTTTTTTGgtgtcgtcctcgtcgttgcTGGACGTTCGCCATTTTGGCTCGTTTCTGCCATTGTTCAACGCAACGAGTCTCCCTGAATATGGCGGT
GGATACCCAGGCGAAGACGGCCGATGCCAACGCCGCGTCGCCCAAGCCCCTGACCAGGGCTCGTGGCTCCAACTCATTCACACTGAAGCTTCTATCGGTT
GTGGTGGTCGTGTTTGCGGTTGCTGGCGGGTGGCTCATTCAACAGGGTGAGGACTTGGATGACGTGGcgttcaaggtgctgcgagACACAGGGCTGCTAA
CCCGAATGTCATCGAGCTTTCTCGATGGCATTGGGTTATTGCCAGACAAATACGAGACGGAGGTTGTGAAGGTCGAGCCACGCCACCTCGTGAGCGACTT
GAAGTGCAACGACTCGGACTACAGTGCTTCGACACTGTTTGACGGCAAGGTGTTCCCCGTCACGGAGCCCATGGAGGCCGAGCAGCCCATGGCCGACGAC
CGAGTCTTCTTCATGCTCAACGGCGCCAACGACGGCGTCTACGTGTCCTGGAACAGCCAATTCGAGTGCGTGGGGCAGGCGGCCGAGGTGGCTGCGGCGT
GGCTGGGGGCAGACCGCGACGTGATGGTGAACGGCGTGCGTCTGTACAGTCAGATGGGCTGGCCCGTTCGCAACgcgaaggagctgcgcgatACGAAGAA
CATcgttcacgtgctgctggacttccaGTTGTGGCAGTGGCCGGGTATCAAGAAGGGGTACAAGTACGTGTTGGAGGACGGTGTGACGTTGACGACTGTG
GGTATGAGCCCGAAAGTGTTCGACGTCGAGTATTTCTTgacccaagaagaagcagataAGGTCATTGAACTGGGCTCGCCGTATCTAGATCGGTCGAAGG
TGGACGGAAGCAATTCATCCAAGGTGGTGTCGAAGTCGCGCACGAGCCACACGGCTTTCCTTCCCGATAACTTCTTCACGAGGGAGTTTCGCGTTCGCTC
TGCTCGCGTGGCTAGGCTGTCCAGTCCATCGTTTgtcgagcggctgcagctggtaCGCTACAGTGCTGGCGAGTTCTACCGCAAGCACTTGGACACCTTT
GCATCGCGACAGTTCTTACCGAAAGGAGCAAAGCACAAGTTTGGGATGAAGGCCTACAAGGAATGGGCAGATTGGGCTGCTGACAAAATCCGTGAGTTGA
GTACGGTGCGTAATATTCCTGAAGACTTTCGTGAAGGAGGGCCGCTCTTCCCGAACGCGGAAGATAACCAGCACTTTCCTAATGCGTTGGCGAAGCTCTT
TTATCCTGAAGCTAATGTCACCAACTTGTTCAAGGCCTTCTCGGATGAAGAGTGGCTTACTTGGCTGGATGAAAACGTTAACAACAACGCACTGGGGGTC
ATGGATAGCCTTCTCGCCGACAACAAGAGGCCAGAATACTTGCCTCTCTTAGTCAAAGCGTGGGAGAAAGCTTTGGGGCTTCCGGAGTTGCATTACACGT
TCCCGAAGCCTGAGATGAACTCAGTGTCGCACTTTTTCGCTTGGGTGCGCTGGGCCAAGGAGCGTATCGATTTCTTGAGCGACGAAGTTCCGCTTGTCGC
TCGTCCACCGGGAAAATTGTACCCGAAGTATACGGTCGAGTTTCAAGAGAAGCTGCTTAGCTTTGTGTTGGACGATCATACTCCAGGGTTGATCGCACGT
ATCACTAATGGTGAATGGTACGATTTCATGGTTCAGCACCGCGGTGAAAATCACGTCCTGTTCAAAGTGCTCAAGGCCTTCCCGCAGTTTGCTGAGCTGG
TGATCAAGACCTGGGAAACCCGCGTGAGTGCTCCCTCTCAACTGCGCTATACGCTGCCTGCTTACGTCAAGCACTTCCAGCCGCAACGATACGTAACGCT
GTTCTTGTACCTGAACAACCAAACAAAGATCGGTGGTGAGACGGTCTTTCCCTACTCTTTGGATAGCTATTCTGACG