Description :
From Genome Similarity Track
Location :
Scaffold_525:17051- 19738
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_525-fgenesh-gene-0.1ADP-ribosylation factor
Pytir_DAOMBR486maker-pir_contig_525-fgenesh-gene-0.6DnaJ domain protein

Sequence
2687 bases(100 bases per row)
CGGGCGTGATCTCGGCGGTGCATCCTGAGGACGATTCGTTCACAGTCGTATACAGTGACGGTCGTACCGAGCAGCACGTGCACCGCATGTGTCTCAAGCC
AGCGGTAGAGCAAGATAGCGAATCAAACCGGGGCGACAACAACAACCGGAAAAACAACAACAGTAGCATTGATGGAGACGCAACGACAGAAACAACAACA
GCTAGCCCCGCGCAGCTGCGCTCTATAGAGATCGTGATCCTGATCATCGGCATCGACGGCGCAGGCAAGACCACGCTGTTGTCGACACTGCAGGGCGATC
TGGACAAGGAGCACGTCCCGAGCGCGGGTTTCACGTCGGCAACCTTCCAGACCGAGACCGGCTCGGCCACGTTCTACGACCTCGGCGGTGGGCCAGCGTT
CCGCAACGTCTGGAAAGAATACTATGCCGATGTGAGTTTGCAGGGCGTGCCTGAGACCTTTGTCTGTGTCACTATGTAGGAGGACTGACTTCGTGTGGAT
TTCTATGATGACGATGATGAAAGGCACACGCAGTCATGTTTGTCGTCGACTCATCCAGTGAGAACACCGTGCACCAGTCGACTGCGATTCTGCAGGACTC
GATGACCCACACGTTGATGGCGACGAAGCCGCTGCTAGTGTACGTCTATGCCTCTTAACATCGCTCGCCTTCTATCAAAGGGGAACCTATCACGCTAACT
AAGTCTCAACCATTTCTTGATAATACCAAACCAGGTTCGCCAACAAGCGCGACCAGCCATCTGCACTCGCTGAGGACGAGCTCGCGCGGTTGCTTCAGCT
CAAGCAGTTCCCGAACTCGAGACTCGTACCGTGCGTCGCCAAGCCCGGAGCGTTCAGCAACATGGTCGACGATCGACTGGAGCAGGGCCTCCATTGGCTC
TTTGAGCAGGTGAACAAAAACTACGACGCTCTCAACGATCGCGTGCAGGCCGATCTGGCGGTCAAGAAAGCCAAGGACCAGCAGCGACGAGCCGAGCAGC
GCGCGCGGGTATCTGCGTGGAGAGAAGAGCGTGAGCAGAGAGAAATGGTGCTCCACGACAAGTCGTCGCTGGCACCTCATGACGAGAGCGAAGTAGGTTC
AAGTACTACTATGGACCAGCAGCAGATTGGAGGAGCCACAAAGGCTCAGAAGCAGGGCGAGCAGCCGGAAGAAGCCGTGATTTACTGCTCCAACTGCACG
TCGCAGCCTGCGGTGACGAAGTGCGCGGCCTCCAAGTGGATGCCCGTGTGCGCCGCGTGCGCCACCGAGCTCAAGAGCAGTCGGTAGAATAGAATGCAAA
CTCTTCTAGACCCACGGAAGTTGGTAAAGATCGAAGTCTATTGCGAAGAGCTCAGCTGGGCATTTCCTTATCATATCTATCTCTTCTTGCCCTTACCGCC
TTTTCTGCGCGACCCGCGCTTGCCATTGCCTTCCTCCTCGCTGTCCGTCCAGTCGTCTGTCACTCTGGAGCTCTTGGCCGTTGCGTCTGTTGTTGCATTG
CTGCTGCTGTCTTTCTCTTTGTTGTCTCTGTCCTTGGCGTTCTTGCTCTTGCTATTGCCACCACCGCCAGTCACGATCTTCTCGACGCCTTCCTTCTTCA
GCTGCTTGCGCTGTTCCTTACGCTCTTTGCGCTTTTCCGCTGCCTTCTGCTCCTTCAGCAGACGCGCTTCCTCTGCTGTGCGTGCGGCTTCTGCTTCTTT
CTCTCTTTGCTCGGCTTCTTCAGGGGTCTCTTCCTGTTCTTGCTGCTCGTCATCCTGAGTGTCGTCCGCCTGCTTTTCGCTCGTTTGAGCCGCCTTGTCC
TTCCCAAAATCACCACTCTTCTGCTTGCGAGCCGCAGCGAGTTCAGCTTGCAACTCAAGCTCAAGCTCGGCCTCAATCGAGTTGTAGTCGCTGCCGCCGC
CAATGCCGAGCTCGGCCTCCATGTCGCGGTGCTTCTTCGAGACCAAGTGGTTACTCAGTTGCTTAGCCGACTTGAACGTCTTGCGGCACAGGTCGCAGAG
CAGCAGGTCCGCGTCCATCTTCTTGCGCATCCTCTCGAGCTCTTCCTCAATGTGGTCCTGCGCATGTCGACTCGTCTGGTGGCTCTCCATGGCCTCCCAG
CGCTCCCTCTCCTGTTGCTGGAACGCCAAGCGCTCGGCCTCGTACGCCTCCTGCTTCTCCTTCTTTCTGGCTTCTTCGTCGCGCTTCTGCTGCTCCTTCT
CCTTCTCCTTCTGCTTGAGGAACGCGATCATGCGCTGGTCGCGACGGCGCACAAAGTCCACGAGCTCCCGCACTTCGGTCGTGAACGCCTTCTTCGCGGC
GTCGCGCAGCTTCTTGTTCTCCTTCTCCATCGCGCGGCGGATCTGGCGACTCGGCGCGTCCAGCGTCCGGTACTCGTCTACCCACGCGAACGTGCGCTGC
GTGATGTAGCTTGCCCAGTACTGGTAGAAGTAGTTCACGTCTTCCATGGGCGTGCGCTTGTCGCCAAACGCCGGCGCTTCCTGGGGTTTGTTGGTGGACG
TCGCAACGGTTGCAATGTCCATCTCGTCAATCTATTCATTCAATAGGACAACGACAGCAATTAGAACACCAGGTCTCCTTGTGCAGCCCCAGTAGGAAGG
TTGCAATCGTGTTGTACCTTCTTGAAGAGCGCGCCGTAGACCGAGTAGAAGCTCTTCTCGTCCTTACCAAAGCCAGAGTACACCGAA