Description :
From Genome Similarity Track
Location :
Scaffold_218:17050- 19908
Transcript NameFunction/comments
Albla_Nc14101690conserved hypothetical protein

Sequence
2858 bases(100 bases per row)
ATCGCTCTGTATCGCACTCAGGTGCTCGAATGCTTTGGTATGAGCGACACCCACCGCTTCTGCTCGCTTTTCTTTCCAATCGCGAAGACGATCGGAAAAG
GAGGGAGTCTCTACAGGCTTACATAAATGACGTAATCGATTCCCTTTTTGATGAAAATTTTCAAAGCAATCCAATTGTCCTATCCGCCGAATGCTGCAGT
ACTGATCGCCGCATTTGATACATCTTCGATCAGCTAATTCACCGCATTCCACACACATACTCTCACGATCAAATTCAGCTTTTAGGCGGTTGTAAGCAGA
TTCACCGCAGACGTAAGCGTGACTGCCTTGATTACACACGTGGCACAATAGCCGCTTGCAGTAGGAGCATGTCACCTCACCACGTCGCGAAAAACACTGG
TCACAAGCTTTCTCTCCGGGCTCAAGTCGTTGCTGTACTACCTCAGTATGATGATGCGCTTTGCGGCCTTGGCGGTGCCCAGTAAGTCTCATGCATTCTT
CACATAAAACTCCATTACATGTCGAGCACACCGAAGTAGCTATGAGCGTTTGACATTCGTCACAAACCCTTGCATTTTCCTGGTAAAACTCGCAAAGATG
TTGCTTCCTTGTGCTTCCTCCACGATGAATGCGATCAAAACAGCGTCGACAGTAATGCTCTTGGCATGTGAGACATCGCATGGTAGAAAATCTGCCGCAT
TCTACACACACTAGCGGTAGCGGAGTCAAGTTTTCGATCATCGTGTACGAGTGACCGCTTCGTTCGGGATGCACTGCGACATTATGACACTCGATGAAGC
ATGCGATACAGAAATGGAGGTAATCGCCAGATGGTAGAAAGCATTCATCACATCGCCAAACAGCTCTGTTGGAGTGACAATTACTGCACAATGTAGAGAG
CTGAATCTCCCTTGAGGCCTGTTCATGTTCTCTTTCTATATCTGGCCACGCTTGCTGCCATTCTCTTGTCAACTTGTCCTGCACCATTGGGCGGTAGGGA
ATCAATTGCCCTTGAGCGTCTCGAGGCTCCTCTTCCATTCGTTCCATGCTAGGGCGGTAGATGTAGAAAAATTGCTTTGTTTTCACAGCAAAGCACTGCT
CATAGTCTGATCGTAACTGCTCAAGAAGCATACTATGGATCCCTTTGGCTGCATACTTTTTCCAATTACTTTGGATCGTTAGCGCTGATGACGATCGATC
CGCTTGTGTGAGGCGGTAAATCTCTCGCTGAAAGCGCATTCGGGTCAAGGATTGCACAACTATAACCGATCGAACCCAGACGAGTGCTCTTTCAATTGCC
TCGGAACGAAGGTACAGGGCTGCCTGAGCATAGGTGAGCCTCGGTACGGTGACACTCGGTGGACGTTCCCAGTACCCTCTCACAGCTCTCTTTGCAAATT
GAGATATGTAAGCCTGGTAATATGCAGCAACTTGATCGGTATCAATGACAGCGTACGGGATTCCCTGATCTTGTGAATCATCAATCCCCAATGCGTATTG
GACGACAGCTACAGCGATTGAAAGCTCGCCTCGTAGCCTTGAGAACTTAAGGATCGCACAATAAACGATACACTTTAGTACAGCTCGCAAGAAAACATAA
AAGATGAGCTTTTCTTGTCCGTCGTTTGTGGTCGCGCTCCAGTCACTGATAGACGAAAGATTCATGAGCGCTTCATCCGGTCGTGCCCCGTACCTCTGCA
CATGCGATTCTAATTGACCATACGTCACAGGGGTATACTCTTTTATGGCAGTCCGAAGCGATACCGCACGACTCTGTTGATTCGGATAAGCTTTGGCTAA
GAGGTTATGAAGGATTCGGTCACTAGAAATAAAGTTAAACGGATGCTGAGCAGAAGGTAGAATGCTCCAGCAACCAAAACGCGTTAATGGAAATCGATTG
CGTTTTGCTTTGATGGACGGGCGTTGATACAAAATAGCAAGTTCTTGTTTCTGGAGGTTTCCCAGTAATGTACTCCACTCTTTTTCGGTGAAATGTAGCA
CGTCTTTGGCATAAAGCTTGGAGGATCGCATTGTGTCTCTGTGACTTGGAAGTGCTAGGCGATCAAGAAATACGGATACCTTCATGCCTTCGTATCCAAA
TCCTATCCACCCAATCGCCTCCCCCTTAGCTATCGCAACATGCATGCAATCAACGATCGACACGGAAGAGATCAAACGAAGGTGCTCGAGTCGAGCTATG
AAACGACGTCCAAGTGTCTGCAATTGAGTAGCGGCGTACTCTTCGTCAAAGTCATATTCTGGACGATAAGCGCTATACTTGTGTGTGTACAACTGATAAA
ACCATTGTTTACGTCCGTGTACAACAGCTGTCCATCCATATCGAAGTGCTGGAAGTGTGCATTCAATCTGAACGCTAATGCTACTGGAAATCATCGAGCG
ACGAAATACCTCGTACGATGATATTAGCGATCGGACTGAGCAAATATGGAAAGTCAATGGTGTGAAGAAGTTATTCCGAACGGTATGGTCATAAGCATGT
TGCAGAGCCTTGAAGAGTTTCTGTATGTTGAGCAATTTCGTATTCGTAAGATGGATACCCTCCGATCGCTCCGCCCACCAAATGGCTGCGAGTGCTTCCA
CGAAAGGAGCAGCGTGGATTGTGCAATTGACAGGCCCACGCTGTGTCCCACGTATTTGTATCCATTGTAACTTTAAAGCATGTTTTTCTTTCTGCCTTTC
GAGCCTTCGACGTTGCCATTCGTACTTTTTACGTGCTGCATATGCTCGATAAGCTTTTTGAACGCGGAGAACCATATATTCTTCCGATTCCGTGTAGGTT
GGTCGCTCTGAGAGTAGATCTTTTTTATCTTTCGAATGTATAAAGACAACAAGGCGAT