Description :
From Genome Similarity Track
Location :
Scaffold_571:1705- 3898
Sequence
2193 bases(100 bases per row)
AATCCTCACAGTTAGCCACTGACGTATTGCCTGGGCGATGAGGGAACTGTACTACTTATTTTAACTTGGAAACGTGCACTACTGGAACAGTTGATATATC
TCCAAACGGACCGCATGCTGTCCGCACAATTCAGCCACTCGAAACGGTCAATGCCACATATATGCTAATTGCGAGCGTAGCCGTCTTTGACCCGATCCAA
ATAAAGCTAAACCTGCATCCCACACTTTATGGTACATGATTCATGATTGATATTATTCTGATCCGCTCGATCTCGGATTNNNNNNNNNNTATGGAGTTCT
TGCGATCTCCGAACGGACTGCATGCTCTCTACACAATTCAGCCACNNNNNNNNNNGCTCGAGTCAACATCTTCACCATGCGTACCGCGGTTACACTCGCT
TGCGGTCGGTAAGCCATNNNNNNNNNNTTCCGCACACTGCTTTTGCTCTGCGATCCAGTTAAACGTTCAAAAAAATCTGACATAAATCCAGGTTCCCGGT
AGTGACGTATCNNNNNNNNNNACATCTTGATCGCCATGCGTTCCGCGATTCTGTTCGCTTGCGGTCGGTAAGCCATGGCCTCATGCTGCTTTTGCCCTGC
AATCAGGTTAAACGCTCAAAAATCTGACATAAATTCAGGCTTCCGGTCGTGACGTATCGCTTCGCTTGCTCCAAATCTTCGGAATTCACATTCCTCANNN
NNNNNNNTCGCACGCCTTTTTTGCCCTGCAATCTGGTTAAATGCTCGAAACAATTCTGACATAAATCCAAGCTCACGGTCGTGACGTATCGCTTCACTTG
CTCCAATATTCGGAATACACATTCCTCGTAGACTTTAGCGATTGTGCGGTCCTCGACGAACTTGCTCTNNNNNNNNNNCCAACGTCGATCTTGGATACCA
GCCATGGATTAAGTAAAACGGGGTATCTTCACAGACGCTATCTTGTGCCGTTTTCATGTCAAAAGTCAGTCTTTTCGCATATTCATTCCAATCCTTCTGA
TCCNNNNNNNNNNCGTAGCCTTCAGCAATCGCTTGTGCAGTCCTCGACGAACTTTCTCTCGCGATCACGTAATCTGAGAATAGATCCACCCACAGCAGTA
GTTNNNNNNNNNNCGACCACCTGAGATGGATATGTATCCTGTATATTACCCGGGGATTTGCCGCGGATCGCGGGTAAAGCTTTCCCAGTTGTGCAGTCCA
CGCATTGCTAACATAACGCTGGATACTCCGATATGTACCTCTCCAATGGAAGTAACACCTGATACGCTGATATGTCCTCCCGANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNATCTGCCCACAGCAGTAGTTTGGTGCTTCCTTTAAATGGCCGTGGCAGGGACGGGATGTGATGTGATCCATTGGGATCACCTGAAATGA
GTATGTTACCTGTATATTCCCAGGGGATCTACTACGGATCGCGGGTAACNNNNNNNNNNTTTTGGAAGATCGGGGGCTGAAAAAAAGCAATCCATTTTTG
ACGACTTCGTAGTCTGGAGCGATCCGAGCGCATAATTCTGCATCTCCGGCGTTCAACTNNNNNNNNNNCCCTCCAAGCTCTTGTGGTAATGTTGAATAAA
GCCCTGTTGTAACAACTCTGGCACACCCAGACGGACCATCTCCATGCAATCGTCCGACTGTTTAGAAGATNNNNNNNNNNCTGCAAGAATTCTGGTACAG
CCAGATGGACCATCTCCATGCGATCGTCCGANNNNNNNNNNCTCCCGGTCACCAAGGGTGACCACCTTCCAAGATCGTATGGTAATGGTGCATAAAGTCC
TGTTGTTATAATTATGGTACATCCAGACGGGCCATCTCCATGCGATCGTCCGACTGTTGGAAAGATCGGGGGCTGAAAAACAGCGATCCATTTTCGTCGA
CATCGTAGTCTGGAGCGATCCGATCGCATAATTTTGCATCTTCGGCGCTCAACTGGGTTAAATGTCCTATAAGATATTCCTTCAGGTTGGCGATCCANNN
NNNNNNNTGCACGGATCGTGTGATTGCTGTCATCTTCACTACACAGTCCACCTTTTTTGGCANNNNNNNNNNTGGCATGAACAATTCGCCCAG