Description :
From Genome Similarity Track
Location :
Scaffold_494:1705- 3402
Transcript NameFunction/comments
Aphas_H257_19188Folate-Biopterin Transporter (FBT) Family

Sequence
1697 bases(100 bases per row)
GCCATGGCCAGTGTACACGACAACAACCGAGCGCTCGACTTGGAGCAGCGCGTGTCATATGTGCACTCGAACGCAGGTGGAACCAAGGAAGGCGGCGACA
ACTACGTCGATGTCAAGACCCCCGGCGAGCTCGAAGACGGCGCGATCGTGGACGGCGGCGCGCTCAACCTGTTTTCGCGCGAAGCCCTGGGTTTGTTCAT
GCAATATGGCGCCATCGGGGTCATCTACGGCATGATTCCGACGCTGAGCTACCCTATCTTCACCGTGTACCTCAACTTGGAGGGGTACCAGACGGCAGCG
TATGGGGTGCTCGTGACGTTGGGGTGGTCGTTCAAAGTCGTGTTTGGGATGCTCTCGGATGTGTTTCCAATCTTTGGGTACCGGCGCAAGCCGTGGATGC
TCATCGGGTGGATCGTTACGATGATTTGTCTGTCGTTGATGGCGTTCGACAGCTTGGGCGAGCCCTATTGCAACCGCGACAAGACCAAAACGTGCGGGTT
GGCGCTGGAAAAGGTGCCCAAGTCCGAGCTCCAGCACTACAACTTTGACGCCCCTGACCAAGGCACCAAGTTTATCATTTTGTCCATCTTTGTCTCGTTC
GGGTACGTCACGGCGGCGTGCGCGTCCGACGCGATGGTGGTCGAGTACGCCCAGCGCGAACCCGTGGCCATCCGTGGCCGCGTTCAGACGGCCATCTACA
CGGTACGCACGCTCACGGGCATCCTCGCGTCGCTCGTGTCTGGCTTTGGCCTCAACGGCGCCAACTACAACGGGTCGTTCTCGTTCTCGATGGCGCCGAA
TGTGCCATACCTGCTCTGCCTCGTGCCATGCGTACTAGTGGTCATCTCGACGTTCACGCTGGTCGTGGACAAGAAGACAGAGGGCGTGCCGTTCAAGCTG
TGGGTCGGCAACTTCTGGGACTTGCTCCAACAGCGCGTGATGTGGCAGATCTGCGCGTTTCGAGTGGTCGTGTCTGGCTTGCAGTCGATTGGCGCCACGC
CCGGCAGCCCCATCTCGGCCTACTGGGCCAAAGTCGAACCCCTCAATGACTCGCTGTCGTCCGTGCTCGCGAGCGGCATCTTTGCCGCCGTCTTGGTTGC
CATGGGCAAGTGGGGACTTCATTGGAACTGGCGGTACGCCATCGCCGCCGGCACCATCGGCGTCATGCTCGTGGACGGGTTCGTGCTCATGTTTACGATC
TGGGACGTCGTGCGCAACCAGTGGTTCTTCACGGGCGTGGCGCTGGCCGACAACGTACCCGGCGGCATCCGCTTCATCGTGGCCACGTACTGCGCCGTCG
AGATCGCCGACGTCGGCAACGAAGGCGCGACCTATGGCCTCGTCACGACCATCGCCAACCTCATGGGTCCCCTCGGGTCGGTCATCTACAAGTACGTGGA
CTCGTTCTTCAAGGTCACGACCAACGACATCAAGGCCGACACGACCGAGGTGCGGTGGGAAGTCACGTACGTGTACTTGATCTCGTACTCGTGCCGGCTC
TTGTCGTTGTTTGGGCTGCTGCTGCTGCCGCCCCAAAAGGCCGAAATGCAAGCGTTGAAGCGCAAGGGCGGCCGCAGCAAACTCGCCGGCGCCCTCGTCG
TGTTTGGCTTCTTTAGCGCGATTTCGTTTGCCGTGACCAGCAACGTCATGTCCATCTACCCGTCCACCAAGTGCTTCCGCATCGCCGGCGGCAACGG