Description :
From Genome Similarity Track
Location :
Scaffold_2875:1705- 2739
Sequence
1034 bases(100 bases per row)
GACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGTACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGGTTGTTGGAAGTCGATGAGTCTT
GACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTCCCCG
TCACTGTAACGGGCGAACAAACCGCAAGGTTGCTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTT
CACTGCCGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACCGACGGCCAAACAGAGCGCGTC
AATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTCCCAGTTGTTGAGTTTGCGCTCAACAACGCGG
TGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACCCCTCTATTCTAAG
TGGGGGAGAGGCTCGGAAAGCTCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCACTACGGAAACAAGTGAAATCCTTGGTGGATACCAAGCTGAGC
GTTGTCAGCAGAGTCCGCGATGCCATGGCAGCGACCCAGGATAGCCAATAGGGGTACTCAGACAAACATGGAAGAGGAAACTTATGTGTATTTAAAGTGG
GGGACTTAGTGTTATTAGACACGAGGATCCTACCGCTAGACATGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCGTTTGCAGTCCTGACCAGA
TATGGTGCGTCGTACACCATCGACCTGCCTAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACGCTGATCCGCAGGGGGTTG
CTGACTCGCAGACCCACCTTGGCCTAGCTCCTCG