Description :
From Genome Similarity Track
Location :
Scaffold_538:17048- 22915
Transcript NameFunction/comments
g11392.t1hypothetical protein
g11393.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum
g11394.t1hypothetical protein

Sequence
5867 bases(100 bases per row)
TAGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCACCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTT
AGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTCCCTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTA
TACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCA
CTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACACGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCA
AACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACG
ATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCAT
CGGCCACACCGCGCGGGGAGTCATTGAAACTCCACGTAAGTAGCTACGTTGGAAGAGAGGGGGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGC
CATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCAAGGAGTTGGGCGGACGGACGCCGACTC
ACGGACCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGTGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCAAGGGCGGAGTTCC
TCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGATGAGGCGACAAA
GGTCGTCATGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATTTCTTCCGAGAGTATCCAAATACTCTCGAGGATGCAATTGCGCTCGCAATG
CAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGTCCCGCGACTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGA
ACCTCTCGAGTGCGACGACTGCTGGTTCCCAGCAGCACCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCACAGCACCT
GTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATTGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGAGTCCTGCTGGTGATGC
GGTCGAGCGTGTCGACATCGGACATGCTGCAATGAAGATCGCTACCCCCAGTGAAAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCTGAACCTTGTC
ATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTG
ACTTCGAGGAGGTGAAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACCCGTATGCTTCTC
TTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCG
GTGATCGACTGGACGAAGCGCACGATCGTGCACTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGATG
CATGCGGCCCTTCACCAAAGACAGCGCGGAATGCGGCTGTCTCGGATCACCCCGAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGGAAATGTGAACC
GAATCAGCAGGGCCTGATTCGATCGGATTCGAGAAGGTCTCGAAGCGTCCGGAGTGACGCGGTCGTGTCGACAGGTTTTATCCGCCGGCGAATACAAGGG
ACGACTGTCCACGGTCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGGAGCAAACGGTGCAAGCGAGCAAAGCTGCGCAAGGCTCGG
TCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAAGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGACGCGTACGAGTATTGGTC
TCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCGAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCA
CGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCC
CTCAGCGCAAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTAC
TCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATTACGTTACGCGACAGTGGCC
ACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAAGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACG
TTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTAGAAAAG
ATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCT
CACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGTCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCAC
TTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGATGATGTGTTCATTCACAGCCGGGCTGTGAATGGGAGATCGGATGTGGAGATGCATACAG
AGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTATGCAAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTG
TCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACACCTTCAAACGTAAAGGAACTGCGGCAGTTCCTT
GGGCTCGCCACGTATTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTGAAGAAAGAAGCTGCATAGGAGTGGGCTG
CTGATTGTCAGCATACTTTTGAAGCCGTCAAGCAGGGCTTAACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGA
GGCATCCGATTTCGCGATCGGATGCGCACGATCACGAAGGTCGTGATCGTGTGGTCTACTACCAATCGCGTCAGCTGAAACCAGCTGAGCGCAACTACCC
GGCACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTATACACCGACCACGCA
TCGTTGCGTACGGCGATTAAGGCGCCGCACCTATCCCAAAGAATGGCACGATGGCTGTCATTCTTTGCGGAATACAACTTTCAGGTTGAGTACAAACCTG
GAAGGTTGAATGTCGTGACCGACGCGCTTTCGCGTCGACCAGATTATCCGGTGCAAGAGGCCGACCCCAACGTAGTTGGCGTCGTCAGGACGACTACACC
CTCGTCGTCCTTGTTGGATGACGTGAAGGCTGCATTCGCGCCCGACGCGGACGCGAAGCGGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGT
CAGAAGCTGGCCAAACACCTTCGTGCTCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGATGACAACGCGGATCGCATTG
TCGTGCCGGATGATCATGAGTTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCT
CACGCGTGACTTCTACTGGAGTCACCAATACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGTGTGAAGCCTGCGCCCAACTCGCAG
GCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGATGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACATGGTATTGTGGTCTT
TGTTGACCGCTTCAGCAAGACGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTTGACCTGGTGTTTAGAAAC
CATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACATTTCTTGGGACGCAGTTGTCCATGT
CGACTGCGGATCACTCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGTTGGTTGACACCATGCAGAGGTACGCGCACTCATTCCATCAATGGAG
CGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACACACGCGTA
CCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCGAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAG
CTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAACACAGTGTCTACGACGGGCGTAGACACTTCAAACGACAACAAACAACACGCGCA
GGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGCCGACAAGCCGTAATTCGGTTTGTC
CAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAACGCCGATAACACCAGCAGGGGAAACACAAATGAAGTCAAAGTTGATTCATTAGTTCTGT
TAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAACTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGG
TAACGCGTATACACTGGACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCT
GGTGACTCGCCAAGCGCTCTCGAGCGCGGCGACGCGCTTCAAGGCGCCAGAGAGCCTCGCCTCGACCTCGACCTTTACGTTCGAGGTCGTCTGCGCAACC
TCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGACGCTCAACAGCCTCCCAGCGAGACTCAAGGTTTG
GTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCCCACCCCGTTGTGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAA
CCAGACCCGAGGTTCGGTTCATTTTCGAATTCGTTGGAGAGGATTTCCTCCCCGATACGATACGTGG